Description :
From Genome Similarity Track
Location :
Scaffold_1:2937880- 2945939
Transcript NameFunction/comments
Phypa_INRA-310PPTG_00785hypothetical protein

Sequence
8059 bases(100 bases per row)
AACCATCCACCGTCTTGTTTCTAACCATTTCCTGCAAGGCCCCATAGATCAGGTGTCCAAGGCGAGCATGCCATAGAATCAGAGCTCTTTCATTCTCACG
CGTCATGGCTTTGACTTGCTGCACAGGGACTACGTTAGACCGTAAGCGGTAACGGCCATTCGTCTTCACTAACTTCAGTAGTATTTCACCCTTGCGTAGC
CATGCACACTTCTGTTTGCTCAACTTGGTGAATTCCCATCCATCACTCTCCAGCTTATCCAAGCTTAGCAGATTATTTATTCCGCTAGGAGTATATAATA
CTTCAGAGAGACAGAGCGACAAAATTGCAGGAGACTGATTTTCATTCTTCACTTGAACTCTCAGTTCTCCAACCTGCCCTCTGTTCCTGGATGGGACTCC
TTCCCAGTCAAACACTAACGGACCATCATCTTGGCGCAAATCTGTAAACAACTCCTTAGTCGTGCACACGTGACAGTCGCTCGCAGAATCGAGTACCCAC
TCAACACCAATATCAATTGCGTTTTGCGTAGGTTCCACATTACACAATTGACGCGACATCATATCCACGTGTCTCTGGCTGCCACCACTACCTCCAGATT
TCTTTTTATTTTCCCAACGTTTACGCTCTGGAAGTTGCGATTTCGACTCATCGTCGTCGCGTTTTGAACGCGGACAATTCCTCTGAATATGACCGGTTTC
GTGGCAATTCCAGCATTCACGGTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGATTCAATGCCACTGGAATACAACGTTTTGTGAAGACCCGATCGCAGCTCTTAGAATTGGTAT
GTACTGCTGCACTAGGCAGACAGAGGAGGTAGGAGAAAACTAGTAAAGTCACTTTGGTTGCAAGTCAAATGCATTGTCAATTGGCTACCGAATAACCTAT
GTCAAAGCATAATATGTGTTGCCACATAGACTGCAAATTAGCCAATTAGAGCACAGAACGGCCGTCAGGCCGTGCACCCTATGTCGTTGCACATGTATGT
ACCTATTCTAACGAGATACGTGTGCTAATGGGAGCGTTGGAAATAGTGGCAGCAAAGTCCAACCCGCAGCAAACGATGATCTCCATTGAAAGCATGGAGG
TGGCTATACATCCACAAAAGAAAACGGAGCGATCACAGAGGACGAGTTCACCATGCCGAAACCTTCTCAGGTCTTTCTTCTTGGTACAATGGAACAAGCC
AAAACTAGGAGTGCTTAAACGGTGTAAAAGCCTAGCGAACCTAAGGACAAACCAACTTTACCACCCCAACAAAGCAGAGGAGAGCTACAGAACCACTTAC
CCATGGAGATTGCTGCTTTATGAGGCAGCAGAAGACAAAGTACTGGACAGCGCGGCGAACCAACCGCAGGAGATTCTTCTGGCATCGATCAAAACTCAGT
TACGTAACTACCAGGCTTCTATAGGTACATAAAAACAACACCCAAATAGAAGGCCAACTTAACACACACCTATTCTAACGAGATAGCATACATTTTTGAA
CACATACCAGTACGCTAGACGGTGTCGATGACAACGACAAGGGCAATATCGCCGGTGAAGCCCTCAGGGGCGGTGAATAGGATTTGAGAGTTTAGGCTAT
GTATATAGGCGTAACCTTTAGCGTTAGAGCCACACCAGTTCACTTATGCTGGGACAGGAAATTGGTGGTCTATGCACCCATTTTTGCTGGCTCTCTTGAC
GTAGACTATTCGATATCTATACACATCTAGCACCAATGTGTTTTTTTAGCCGTTTGTGTGATCACTGTCTGTCATGTTGCCCACACTGGCCGGCGTCGAC
CTCGCTGTCGACTCTCTAAATGGAGGGCGCAACGTGTAGCTTGAGAAATCAAGAATAGCGTCGATATTACCGACGTTCACCTCCATCGCGGATAGTATAC
CCTGAATCTAGATACGCCCAAGCCCGTACTGAGTACGGTACTCTGCGTCTGCAAGCAGCGGGCCATCTTCCATCGCGTCGTGCATCGCTATTTGCAGCGT
TTCGATCTGCTGAAGCTGGAGAAATGTTGTATGGTCTGATACAACTAGCGGTACCCTGTTCGGAAGCCTTGCTTGTGCAGTCGTCCTGTAGTCCTGTGAT
GCGGGACCCACCGGTACTCCCTGTTCTCGAAGAAGACTGGCAACACGAGGCATTTGTTCTTGAATGCAAGCTCCTCTTTGTAGTGACGTCGTAGCCTCGA
CCACGTTGGGTACGTATACACAATGTCCATCTCTGCGCAGCTTTCCTTAAGTGATGCTCTATTGAGCTGAGCTGCATACATCCTGTCGCTACAAAGCACC
TGAAAGCCGTTTTGGTGCGCGGATTTGGTGGGCTTAAGTAGATGGAGAACTCGGAACACCACTGACCCGGCAGATTGCTCACAAAATGCTCTCCATTCTT
TGGCACGAAGGACACCGTATCCATCTGCTATTTTGAAAATTGGAAAATAAATGCTGGCGAAGGAACAACTTTGCTACGGCATGAGCCGTGAGGATCTCCA
TTCCTAAAGAACAATCGTCAGGTTAGACCCTCAGGAAGACAAATAATAAAGTAACAACAACTCCAGCAATGCTTACTACAGGTTCGCGTCCACCAGGCTT
GAGATCAGAATTACACCAGTTCTGGAGCTCTGCTATCATCAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGAGGTGGTA
TGAAGGCACGGCGGACGGTGACACTCCAGGCTAGTAGCTCGGATTCGGTGACGGAGCGTGCAGCCATTGCCTTTCGCATCTTTGTGACGTACGGGCTGTG
GTCAAAGAGGCGCAGCATACCAGGGTAGTGCAAGATCAGTGTGGCGGTCAGGAACTTGGCTACGTCTTCGTCAAGGTTGAGGACATAGTCAGCAAATCCC
AGAGTGTTCGAGAACACCAGAGCCTGGAGTTTGAGTGCACCGGTGTGTAAAGTGCTGCGATTGAAGGCAAGCGAGCGCCTTCCTTAGGCTTCCACCCGCT
CAAGACTCGAGATACCTGCTGATCAGCTTGTGTCGTCACAAGCATATAGCCAAACGCTTTGTTTACACAGTCGAGCTGCCACGTTGGATAATTCAGTTTT
CGGCAATGGTCTCGTCATTTGCATACATAGCCCCACCACGGCGAAGCGAGTGAGAGGTGAGGCCAGGGGTGAGCCGGATATTACGAAGCTTGGGATTATC
TCTGGCCCTAACGATCAGCCTCTTAACGTAGGTTTGAGCTCCAGGGAGTAACGCGGCTGCTGAGCTTGAAGATTCTGGTATGGAAGTGTGGTCGTCCTCT
GTCTCCAGAAGCTCAACGAGAGACAATTTCTCCAGATCTTGAATGCTCACGAAGCTTCGCTTCTTTTTAAGAAACTGAGGAAACATTTGTTTGCATGGAG
AGTTCTGCATCACCAGCGGTACAGCTATATCATTGAGAGGGCATGTTAGAAAATTGTTGGAGTCTTTGGACAAGGACATACCCTGAAGCAATGCTGTTTT
AATGCGCTTAAACCGAAGGAATAAACAACGCCTACTTAATTAAAATCTAGTTAGAACGTCAGATTGTTTGTCAGATCAATTATTGCGTACCCAAGAGGAT
AGACAGTTGCTGTTTCTCGACTTGTTCTGCGTCCGAACTAAGTACCACATCATACCAACTAGAGCGTAATCAAGATATTTACTCTCATTTGATGCCGTAG
TGTATAGTATTCGCACAATTGTTTCTAATTCTTGTTTTGAGCACGGGGGAGCGACTCGTTCGTTACCACTTTCTTCTCGATTTGTGCAGTACCTTCCGAG
TCTCGATAGAATCTGTTGTAGCTGGGGCTTCGCTAACCCGCTCTGTAGCGGGTATTTATCTACCAACCAGTTTTTTTTTATGTTTCCATAGTATGCAAGA
CATTTATTTGTAGCTAAAATTTTGTCCTGGGACCGTGCTAGTGAATTTGCATACTTGTCTATCATAATACGAAGCACTTTACCTGTCTTATCAGCATCGA
TAAGCTTGTGCGCGGCTGAAAGTGTCATTCCTTCGGCATTCTGAAACGTGATGAAGGAGTTCAACGCTGTCGTTCGCGCCTTCTTGCTGTTATTGTGAAT
TCCGTCCAAATTTGCCGGTTTGGGTCTGTTCGAGGAGCGGGAGGACAATCGCCCTAATATAAATCCAAGTCATTAGTAGAACCAACCAAGTCTTTTCTTA
CCACATGTCAGGATCTTATTTCGTACTTAAACGGGTCAGTATACGGTATTGTATACGCTGGGCTATTTGGGGGAGGTTCATTCAAAGAACCGCCCATGGA
AATTTTGAGTAGAACTCACAATACCAGGGGCCAAGGATGTTATCGACATGACTGATACTTCGCAATTTTATCTATGTACAGTAACCCCCTACTGTTGGCT
ACCGTCAGAAACTTCAGGATATTTTTAGAATATGACTTTATATAGAAGTCAGTATCCGATAGACACTATGTTTCAAAGATTCTAACTAAATATTGTCAGA
ATGGTTGGAAACCTGCTCCTATCCAGATGCTTCTTCCGTTGGTGTAAAATAAGCCCTTTGTTAATGAGGATTGGTTGAAATACGGAAAATGGTGTTAGTA
TGTGATTGCATAGTCAGGTAACGGTTGGAATGTAGTGGATATTATACCATAACATAAAATCTCCGACCGTCACAAAACAGGTCCATATTTGTATGTAAGT
TATGTACTTGTGTAAGTTGCTTCGGGGATCATATTTTGGGATTTGCACAAAAGGCGATGTGTAACGAGTTTGTAGCGGGATTGTTAGGCTCCGAAACTGC
CTGTGGAAAAAAAAATGAAAACGGCAATTAACTGATTATGCATTATTTAAGCCCTGAGGCATATTCTCTCTACATAGCAAATAACAAAATGAGTTTTCCG
GACCAGAAATCGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN