Description :
From Genome Similarity Track
Location :
Scaffold_6:293761- 294960
Transcript NameFunction/comments
Phypa_INRA-310PPTG_03798hypothetical protein

Sequence
1199 bases(100 bases per row)
TACCTATAAAATACACCAGTCTTAAATCTACACTCTAAGGAGCAAGTTGTTCCCTTTGAGGCCGGGAACAAGTGAATGAAAGGTCACTTAGGCAGTAAAT
ACCCTTAAGTACTTCCTCTGCGAAATGTACTCGTGTTCCCCGCCGCACTGGGTAGCACTCGTAGACAACCCTCTGCCTACGCGGGTCGATGAGGTTTAAA
CGCTTGAGCCCCGATGGACCGAAGTGTGTTCCCTCACTTGAAAGACTTGCAGTAAGAGTCGGTTCTGAAGATTGGAGGCATCAGAGACTTTTCCAATAGT
CTTTGTCGCTACTTTGCCCGCACAAAACATTGGGCAAAGATAATGTGCAGCATCCACATTACGAGCTTTCGCAGGATTCAATATCTTCAGACCAAAACCC
TCCCAAATCTGTTCAAGCTCTCCACTACCAATCACTTTTCATCCCGCATGGAGCTGCTCCTCCTGCTCCCCGAACTCCTTGGCAACGCAGTTACGGCTGC
GGAGGCAGCTCTGTTACTCAGCTTCGAACAACCTGAGCGTCCGATCATCCCAGATGTCAGGTTTTGCGTCACAACTCTATCGGACGAAAACTGTAGGCAG
CAGTTTCGCTTTGATGTCGCCGGCGTCATCCGCCTAACGGAGCTCTTTGCTCTTCCGGAGTTCGTGATCACGGGTTCGCGCGATAAGGCGCACGCCACTG
AGGCAGTGTGCATCTTGCTCCATCGCTTGAGCTACCCCAAGCGCCATTACGACATGATTCACAGATTTGGGCGCTCCACAAGCGCCCTGTGCCGTATTTG
CATGCACGTCGGTACGTTCTTGCGGCGCGGCGCTCCAGCCATGGTCCTTAAAGGAGATCTGAAAGTGCTGAACTCGTGGCCACGAGTGGTGTTGGTTGTG
TGAACCACACGTATTTGGTGGAGAAAGCTGTTTCCACCATCGCGATTTCTGTGGACTCCAATCCTCACTGCTGGCCTCACTGGACCGTCTCTCGACTGTT
TTTTTTTTTGGCTTTGTGGGGATAATGTGCGGGTGCAGTGACTTGCGAAAAGTCTCTATCGTCTGGCAAATGTTCTCCATAGCTTGGCAGATGCGACGAT
CGCCGAGCAACTCGAGCGCGTGAGTGCATTTAGACTTACGAGCGTGGTCTGATCTCTCGTGTTCGCGGGGGTCTGGAGGCCTCCATGCCAGGCGGAACG