Description :
From Genome Similarity Track
Location :
Scaffold_30:293719- 299437
Transcript NameFunction/comments
Phyin_T30-4PITG_13704Crinkler (CRN) family protein%2C putative

Sequence
5718 bases(100 bases per row)
CTGGTACCTCTCAGGATGATCGAAGCAAATGATACGCTTCAGGTAATCAATTAACACTGGGTGCAAGTCAGATTCGGTAATTTTTTCGTGCAAATCCTTC
GCCAGTAGTGGATTTGTTAAGCTAATTGTCTCCATGTCATTTGGATCATGTTCCCATTTGCAGACAGTATTTGCAAACTTGTGGAATGGAGCCGTATTGA
GAAGGTCAGACAGCTTGATGGAACGTGGCTTCTTGTTTTCAATGAACGGAATTTGCACCTTGAAGCAGTTCTTTGGATCATATGCCTTGATCACAAAATT
ATCGTCCTCCGTTGGCTTACGCTTGTAGTAGGTGATATCGGTTCCTTCAAAGACGTAGAACTCGTGAATGAAGTAGAGTACAAATCGTTTCAGCACATGA
AGAGACTCGAAGCTGGTAGTTTTCAACATCTTCTCGAAAGTACTGAAATTTTAATCAAAGTCACGGTTGGGCTTGTTCTCGATCACTAGATACTTCTCTG
CCCAATATTCAAGCTCATCGATCTCAAATGATGTATCCACCATGGCTGAACGCATGTCGTCAATTGTTCGGCCAGGTAATTCCACCAGTTGAGTTAGTGT
TGCCAACTTCCACTCAGATTTGAATGTCAATTCGAAATCATGATCAGGTGTGGAATGCTCAAACGTCTTCGAAGTGGAAATTTTCCTTGACTCCTTGATT
TCATATTTATATTTCCATTGCTTGTATGCAGCAAAACTACAACCAGCAGCAAGCCCTATCAATTTGCCTTCGTTCAGTGATGGATTATACTTGGAATCAA
ACCAATCATCGAAATCTTTAGTAGCACACTCCTTGTTGAAACGCATTACTTGTTGTTTGATTACACATAGATATGTCTTGCGCATCAAGAACCAATCAGA
ATGAGGTGGACGAGGAAAGAATCCAGCGAGATTTCACACGTTTTGGTTGTTGCTGAACCAAATATTGTGAATCATCATGTATAATTTATATAATCGATTA
TCGTAGATTTAGTTGCAGTGCAGTATTCCACACCGCATTCAACGGTCACTTTTCCAAATGATTCACGGTCTTCACTGGACTTAAAGAAGAAGTTGTCAAG
TACATGTGATCCATCCAGTTCATTGATTTGATATTGCAAGAGGTAGGTGTATCTGTAACGGGGCGATGTACGCTAAGTGTACCCTCATTGGTTGAAGTGT
GACACGTCATACTTCGGGATATTTGTACAAAGTACCAAGGTCGTTCAAATCCAACCATTGGCTAACGACATTGCATTTCTATAGGTGGCTTATAGTTTTG
ATTAAACCCAAGCTTTATCTACCTATAAATATACTCAGTTTACATTCTACCTTAATTAGGTCACTTCGCTCTCTTTTGAATAAAGAGGAGACCTGTGAAC
TGCCGTTTACTGAGAGTTTGTATACTCTCGGAAGAAAACTTCCTCTAGCGCAAGGTGACCCCGTCACAGTATACGTTGTTGCCAAAGTCAGGCGTGACAT
CATCGCTATGCTTGTAATCAGCGGAATCACCAACTTCGTGCATCTTCGACTTGATCCAATCACTTGGTGATAAAACTCGTGAATCCCCCAACTTGGGCTG
ATCGTATTTATCGACAGATTTCATGTGCTGAACACAATGCTCACTATAAATTTCTTCAATAGACTTGGTCATCGTTGGTTCAGCAACTGCATGTTCAGCA
ATCACTGGTTCAGCAACTACAGGTTCAGCAACTGCTGGCTGAAACTTTGCGTGGTGTCGGCACCAATCGCCTTTTGGGTCGCACTGTTGGCTCGTCTTGA
GGTGGTTTTCTGGGAAGATGTACTTACACATTGTTTTCTATATATTTAATTTAACCGAACTTACTATTATTTAGTTCCTATATATTGAGGAATAAATTTG
TCAGAAATAAAAAAAAATATTTTGAAGTGATCTGATTGGTTAAAATGAGCGGTGTGTTGCGTGAATGAGTGCTGCTGCTAAGTCGAGAACTTTCCGCACG
AAGATGGCAGAGGTCGAGTTGGAGTGCGCGGTATACGGCGAAGGGACTGTGTTTCCCGTGAAGATAGCGAGCAATGCGAAAGTGAGCGCGCTGCAGGAGA
AGCTAGCTGGCATCTTGAGCACCGAGCAGCACACTGTTCCCTCACGATTGTTGACGCTCTACTTGGCGCGGAAGAAGGGGGAAGCCACGTGGATGAACCA
CGACCACACGGTGAAAGGCTTCTTGCGAGGTGGCATCAGCACCGAGTATGAAGAGATGCTTTCGTCGTGGATTCTCGACGAAGATTGCTTTGGGAAGAAC
TTTCAGCCTGGTCGCAAGGAGATTCACGTGCTGGTGGAACTGCCACAATTGTCGGAAGCTGAGCTGCCTCGAGATCGTCAACTTGTTGTGGGCGACGTTC
ATATCCCAATCACGCAAAGTATGTCGTTGAATCCGCCAGCACTGGTCGCATTTAGGAAAGCATTTCTGAACGACAGTACCGACGTGAAAGCTGGCGCATT
GGTCGAGTTACCCCGAGACACGTATCTTCTTGGTGATTCGACACTCGGCTCTCGTATCTACATTCGTCATTGCTACCCTGCGCTATGGGAACTTTGTCTC
GAGAGGATCCACGATGAAAAGACGAACACACCGCATCTCGTGATCCTCGGCAACCCGGGAATCGGCAAGACGTTTTTCGGCTATGTGATCGTGCTTCATC
TTGTCCGTACTAATGAAACGGTGGTATATGAGAGTGGTGGCCTCAAGAAGCGCTTTTTTTTTGCTCACAATGTGGTGGCTCAAGGATCTCAGGAAGATTT
TGTGCACATTCTCGACCAGCCGACTACATACTACATCGTGGATGCCGTCAAGCCTGCGTATTACCCAGCGAAGACGATTCTTTTGACGTCGCCGCGCCGC
TCCATCTGGTACGAGTTCAACAAGACCAATTGCCAGTCCTGCTACATGCCAGTGTGGTCTTTGAAGGAGATTCTACAATGTCGTAAGCTGATGTACTCGG
ATACACCTGTGGACGTCGTGCAGAAGTGCTTTCGTCGATGGGGTGGTATTGCTCGCTATGTCTTGCGATTTTCACAAGTTGGTAACCAGCAGGTGTTGCT
TGAAAAAGCAATGGACATTGTTGATCTCGACTGGTTGGTGAAAGCCTGTGGTCAACTTGATGCGAACGACGCTCAAGTGTCGCATCGATTGCTGCACTAT
CGCGTCAGCAAAGCTTTTGACAGCGAGTACTTCGTTTTTGCATCGCAATATGTTCAGCAAGAGATGTACAGTCGTCTGCTCAAGAAGGATAAGCGGAAGC
TGCTAGAGTTCATTGCTGCCTCGGATGGATTTGGTGCTCTTGCTGTGCTTCGTGGCCACTTGTTCGAAGGGCATGTGCATTCGGTACTGCCGCGAGGTGG
AACGTTTAAAGTTCGACGTTTGGTCGAAAACAACGAGGCGTACGATTATAGTGATGACCCTATGGGAGATGAATGGGACGGCGATGACGAGGATGGTGAT
GATGGCATGAATGCAGATGATGCCGTTGCGATGGACGAATCCAATGCTGTGGCGTTGGTCGACGGTGGCGCCGCACCTGTTATTTCTTTTGAGAGATTCG
AGAAAGTTGTCGTTTTCAATGATGACAGTGAAATTGAAGCTGCTACTAACACGAGTTACCTACAGCCAGCGGCGAAGAATTACCAGTCGGTCGATGCGAT
CATCAAGCCGGATATTTTGTTGCAGGTGACAGGTGCACACAAACACCCCTGCAAGCAAAAAGGTCTCCACGATGTGTTGGAGCTTCTGGGAAATCCTGCA
GCACCGCGGCTGTACTTCGTGCTTCCGCCTGACAGATTCACCGATTTCAAATATCAAAAGTATCTGGACTCAAAACGCAAGAGGATGATGGCGCCAAGCT
ATGAGAACGTGTGCAAGATACAGCAGTTTGCGATGGAAGTCAAACTTGAATCGGAGTAGGTGTGCAGTTCCGAGGTTCCAAAACCGCGTTCCGAACCGGT
TCCAAAATGATGCCGTACTTCTTTAAAAAATTAACAATGAGGTTTTTCTTTAAAAAGCCTCGCATGTTTGATTGGTCAATGTCCACTCTGAGATGGGTTC
AATTGGTTAAAATGAGCTCAAATGAGGATTTGTATGCACGCGGATCGAGAGTAGTTGACACAAAAATGGATTGAATTGCTTTTAGTGATATACCACTAGA
TTAAGCTTTATTTGCATTTTTTCTAGTATATTTTAAAGTTTAATTCTGAGGTGTGTTGAGTTGTTTTCCTTTTGGATTATTTTTGACGTCAAAGCAATAA
AAACTCTACCCTCCATAAAGTGATAGTTCAAATGGTCAAATATTGGCAAAATGGGCGGGAAATTTGATCATTAAAAAATTGTGCTGATGCTACGTAAGTG
GGTAGAGCTTTCAAACTAACTCAAACACGCTTCCGTTGGAGCTGTACGACCAAAGTTATCGCCGATTTAAAGAACTGTTAATTCTTTTTCGGACCAGACA
AGTACTTGCTAGAGCTGCTGTGGTGCTTCAATTATATAGTGAATTGCAGTTATATGTGTTAATTGTGGGAACCCTGGTTCCAAAATTTTCGGAACCATAT
TTTAATAAGTAGAAGGGTTGTGGTTACATTGACATTTTCCGTTGTGGCTCGGGCTCCGAGTTCTTATACTTTTATATATAAACAGATAAAATTTATAGAG
AGGGGGGTAAGGGGTAGTATAGAAAGAACATATAGAGAGACAGTCCTGCGTTTTTTTTGTGGAACTTGGGAACTCGGTCGGTGTATGAAATCTACCATGA
TCATAATAGTTAATGTTACGTCGGTTCGGTGACATGGAACCCGTTCAGGTCATGTTTAGGAACTCTACGCACTACTGAATTTTAATAACTACAATCACTC
TGGTAATCCCTCGTTTAAAGTGCCGATCGGGGACAATGTACGAGAATTCACATTAGAATTGCGCTAACTCGCGCGTTCTTTCTCCGGGCGTACGCTAGTT
GACGGACTGCATTGATTATGCTACATCGTCCGCTCAGCCTGTGCATAAAATGGCATCTAGAGTACCCCTAGCCGCCCTTAGATACAGCGATGATGTACCA
TGTAGTACAGTATTAATACGCCACTTCACGCAAGAATCGAAGCTCTGAAGACACTCAAGGACCATTATCGGAAGTGGACGGAGGCTGTCGCCGCCTCGTC
CCCGTCCTGTCCCTCACCACGTCCCTCTGATATCCGAATTATCGGAAGTCGTCACTTACAATAACAGCCGTTATCCCAGCGAACGCTCCATCAATCACAA
TGCATAAAAGAAAAGAGTGGTGCAGCACCAATAGGGAAGAATAGAATAACAAAGGCAGCCAGCAGCAAGAGCCTTTTGCCCCGAGGCCATGAAGCAAGAT
AGGGTCGCAAGCTGCGGCCCGCATCACAAGAGAGGCGACGCCCGGACTGTTTGGCCGTATGAGGGAGGCGATGCTTGGATAGTGTACGCTGTGCTGTCGT
GTGAGGGAGGTGCTGACCCGTAGATGGTATTGAAAGGAGGATTCTGGGTTTGAGTGAGCGTTGTGCTCAACATGGTGGTGCGTGTATGGGACATGCGCAG
AATGACGCGTGAATGCTAGGTGGAGTGCAGTGTTTTGATATGCTAAGCTATTGTCCGAGTGTGGTGATACCTGTACAAGGATAAGAATAAGCGCTAGAGC
GTATGAAGAAGCTACATG