Description :
From Genome Similarity Track
Location :
Scaffold_338:2937- 5495
Sequence
2558 bases(100 bases per row)
GTGAACCACGCACTTGATTTTTATGTCCGTTGCAGAGCAAAACTAGGAGTGAGCTGGCTGGTGGTCGCAGGTGGCCACTGATTGGCTAACCATGGTGACC
ATTCCCAACCGACACTTCCACTAGCTCCTAATACTACTACTAGTACTACTAGAGTGTATCTAACCCGTCGGTTCACAAGATTGGCGCCAAGGGACCCCAT
CGAGAGTCCCTTTGTGTCATGGCGGGGCATGGCTGACAGCCACCAACCACAACACACACCCCAAGCCATGTCGCCGCCCTGACACAAAGGCCTTCGGCTT
TGCTACTGCACCGCCTTTGCCCGCTTCATCGCCTTAGCCAATGTCTCATAGTCTTCGGCGTCCTTCTTGGTCGCCACATACGTTTTGACCACGGCTGGGC
ATTCGCGCATTAACTTCTTGAGCGGCTCCCATGATGACTCGATGTCCTCGAAACCTTGCCAAAACACTTCCAACATGAAGTCGCTCACATCCGGGACAAA
CTTATGTCCCGCGATGGATTTGACCTTCAATACAATGCCTTTTCGGAGACATGTTCAAGGATTTCTTCGGTGACTTCAAAACTCGCTTCCGCATACATCT
TCACGCGTGACGTATGAGCTTCTCGTTCTTCATGTGTCACCAGATGTTCTAACATCACGGAGAATTCGCCCACTAACTTGACGCGGTATGGACCGACCCA
GGTGACAAGTAGCTTGGGATGATAGCGCTCGTCCACCCTTGAGCATAACACATAATCGCCTTCGGTCACGTTGCAGGCTTCGAAGTCTTCTGTGGCTTTC
GCCGCCTTGTTCGTCCGTAGCTCGTTGCGATTCAGCACTTCTTTGTGCATCGCATGCAAACTTGTTCGTAGTTCGTCGAGGTTCTTTTGGATGTCCTTGT
GTTGCCACTTGATTTCACAGAGATCCTTGTTCACGCCCACCACAACGACGTTCAAAGGGGTCGCTGGGTTGAGGGCCGTGAAAAGCTCCATGGGGGACTT
GTTGGCCATGACACTGCCGGGGGCTGGTTGAGATTGGACTGCACCACCGGGAGGAGGTAGTCCCATTCCTTCTCGTCGAACTGGTAGTCCCGTAGCATCA
CGCGTATGACTTGGAGAATATCGCGATTCATACGTTCTACTGTGCCGTTTCGCCATGGGCAATAGGCCAGTGTGAGATCGTGGTGCACCTTGAACTTGTG
CGCCAACGCCTCGATCGCCACGTTCTTGAAATGGGTGCCTTGGTCACTGACCTAGACTCGTGGCATCCCAAATTGCTTCGTCCAGTCCACCAGTGCATCC
ACACACACTTGACTCGTGGGGCCGTCACAGGCCACCAGCTCGCAGTAGTGTGTAAGGTCGTCCTTCAACACCAGTACATACTTGGCGCCACTGTATGCTT
CGCCCATGTATAGGTAGTCGAAGTGAATTCCTTCGTTGCGTTCCTTTGCGTGCCATCTGGGTGCATACGGTCTGTGGACCACCCTTCCCCCTTTCACATG
AGGGCTCAGTAAGCATCCGCGGAGGAATTCCCTCGATGGGTGAGGTGGTCGAGGTAGAATAGGCGCCTGATCGAGGCCACCAGTGCCGCGTGGCCACGGT
GTCCCATGCTGCCACAGTGGGCAACCACCATGATCCGTTGGATCAGGTCGTCCGCCGCACTTGGTATCCATAGGCGGCCATCCACGTTCCATAGCTCACC
GTCAGTGGTCGTCTTGGGCGGTCGGTCACGCGCATGTTGTTCTTGCGCTTGGCGGATGTCATCTACACTCGGCCACACAAAGTCGTCGTCCAAAGGCCGC
AGCTTCTGTTGTGGTCGAGTTGTTCTCTTGGACTTTGCCGGGCGCCGTTTCTTCGTCCACTTGTGGCCACGCCGGACGAGTACTCGTTTTGCCACCAGAC
GTGGAGTCGGTTGGCCCCATCGACTCATCATGTCCGCCCATAGGTTATAGACACAGTCGATGTGGATAATGTCATAGCGGTAGCCGCCAATAATGGCAGC
CCACCGCATGAGTTTCCCTCGGGTGTGTGCTTTCCACTCTTCACCGGGGGCAAACACATGGATCAGGTTCTTGTGGTCGCAGTACATGCGAAATCCAGTA
GGTCGCATCAGCAGGTAGTTGAGCTTTTCGCACGCTCGTGCAATCGGGTACGCTTATTTCTCGATTACTGACCACGACTTCTCCGCGCCCGCAAACATTC
CCCCCGACTGGCATAGTAGTAGCTCATGGTGTTGCTCTTGGATCGCCATCGCTTCGTTAAATGCCACCACTTGCGTACCACAATTGACCATCCATAGTCG
CTGGCGTCCGTAAACAGGCACAGCGTTGCATCATCACGAGGGTGAGATAGTTCAACTGACGCCCGTAACTTGGACTTCACTGCATCGAAGGCTTTCTTCT
CGCTGTCGGTTAATTCCAAGTGAACACCAGACGCGATGCATTTCTTCGTGCCCTTACCCTCGCGGGCCTTTGTCAAGCACTGTTGGAGTGGGTCCACCGT
CTGTGCATACTCAGTCATGGAGTCCCGCAACCAGTTGACTGCACACACAAATTGTTGC