Description :
From Genome Similarity Track
Location :
scaffold_176:29368- 32667
Transcript NameFunction/comments
g5149.t1 conserved hypothetical protein
g5150.t1 hypothetical protein PHYSODRAFT_349401
g5151.t1hypothetical protein

Sequence
3299 bases(100 bases per row)
AGGTGTGGAAGCTCGCAATCGATACGATGAGGAGGCGAAGGCGAGAGAAGCCCCAGACGAAGACGACGACGAGGCATGGGCTAAAACGTCAGCTGAAATG
CTACGGAAGAAGGCAATACTATACGAGGAGATGGCTAATGGAGGCAAAGATCACATGAAGGGGGAGTGTCTGGTGAATTTTGATGCGAAAAGGGATTTGG
AGACGCCAGCGAGTGCCAGGGAGAAGACAATGGTGGACATCACGGACGAGTTCGGACGCACGAGACAAGTTGCGGCGGATAGTGAGGAGTACACAGCGTT
CCTGGAGACGCAACAAGCACAGCACAGGGAAGAAGCTGAACATTATGACGTTATTGAAGACAGGAAAGGAGAAGCTCGTGGCGGTAGCTTTGTGGTTTCG
CAGTGGGAGAAGCGTCTTAAGCCGTTGGAGAAGGATCATTTGAAGGAAGTGCACGAGCATGCGACGCTTGCACAGTCACTGGCGCACTCGTCTTCTGCAG
GAACAATGGACAGGAAATCAAGGAAGCAACTACGTCTTGAGCGTCTTCGTAAACAGAAGGAGCATGCAGTGGTGACAAGCGGAGGTGACACGCGGACGAA
CACTGAGGTCGATTCTGCTGCGTCCAATAAGGCAACAGATTTCTTAAATCAGCTTTCGTCTTTGATGAATTAAAGAAAACCTGTTAACGAACCGGATCAA
CACGTAGCTTGTGGCCCAAGAAGCAAAAGTCTCGATTTATGACCTGAAACACAGTGATTCGAGCACAAAATGTATGTTTTTAAACTTCTTACACTTGTTT
TCCTTCCCATGTAAACAGTGCACACAGGACGCCACGCTATGAATCATTCTCCTGGGCACAATGCTCCGTTAAACGAGCCTTAACGGTGTTCAGAATGGAG
AGCATCGCGCTTGACTCTTCGAGATCTTGTCGAACGACGGCAACTTGCAGCATGACTGGGAGATGCATGATGGCATCTTCTTCTTCCGCAGCAGCAGTGT
CCCCGTAGTTCATTTTGTGGTAATTGAACGCTGCGTCGCGATACTTTTCATACAGCTCAAGGCTCTCTGGGTCTTCAAACCCGTAAGAAGCAACGGTTCG
CTGCTGCTCGCCACTACCACCGCCTACTCCTGCGTTTACGGCAGCATTTTCTTGACACATCCGCTCGTGCGCTTCTCGAATCTCCTCTTCTTCGACCCCG
TACGCCAATGCAAGAATCAAGAAAACTGAGTACTTCCTCTTGAGGTGATCTGCGAAGAAGTTGAGCACTTCAGTAGCCATCGGCTCTTCTCTTCCATCGA
GCCCCTCAATTTCTCGTCTACAGTTGGCCAAGAACAATTCGTGCACTCGGCTCACCTTCTCGTAGACGAGCAGCGCCATTTGTGGGTGGGTAACTTGGGC
TACTAACTTCTCCATCGCCACTATCCGCCGAATTTCAGACTCGGCCTTTTCCTTCTCATCGGAGAGAACACGGTTACACCAGATCTCACTTTGCAGCAGT
GTTACCTTGGAATCTTGGCCCGGAGACACCCAACACTTCGACGATGCTGTAGTTGGGATAGACTTGCCATCGGCTGCTGCGACTTCTCTCTTTTGGTTAC
TGCGCGAGAGACTAGCGTGTTCTTCTCGTTTGACCTTTAGGATGTGACGTATAGCCTTCGTCCACAGCTCAAATGTGCTCTGGTTGTATGACCCGAACTC
CAGGATGCAGTGCGTACTCGCGTGTGGGTTATTCGCCGCGAGATTGTCCACCCTGCTGCCCGATGAGACAACTAAGCTTTGTCGAAGCTCTTCATTCAGC
CACTGTATCAAACATTACATCGTTAAGCCACAGGAGCAGAAACATTCATGAGAATTGGCAATAAATACCTCGTCCAGCTCGTCTGTTTCTAGTAATTTGC
GACGGAAAAGGCGAAGGTTGCTGTCATTGTCGTTCAGCGATGAGTAGCCGTCGACTACATCGACTTTCATGTCACCAAGTAGCATCAGGTGGTGCAGCTC
AATCACCTACACAATGCAGTTGATACAAAAGGAATTCAAAGTCAGATATGTCCATCAACACCCTGGAGTTCTCTAATAGAAACCTTATCGGGCTTGAGTC
CTTGCTCCCACCGCTCGCGACTGGTGAACATAAGAACACTGTCCTCTTGCAGTGACACGAAGTAGGGCACCCACCCACTGATGAAGAAGAGATTGCGTTC
CAGCACCAGCAATGTGTCGTTCAGTGTTTGCTGTAGCACACAAGTGGATATAGAAAACAGAAGACACATGCGCATAATGCACATCTCGTCAGACTCTTAG
CAGAAAAATCTGCAGCACAGCCCAACCAACCATACCTTGTAGATGATAGCAGTCTTGGCCCTGCCCAAGCTCTTGGGCGTCCATGGCGTCTCTCGCGGCG
CCTTGTCTTCCAAAATGATAGAAGCATTGTTCCCGTCGTGCGTCAGCGCGTCCTTGGCGCTCTGGCCCTTCGCTAACAGCGTCTTCAGCAGCGAAGGCGG
CACCTTTCGAGCTGGTTTCACTGCGCAGTTGTCTCCTTCCGCCGGCTCGCTCATGCTCGATACACTGGCCGCAATGCACGACCAGCTCACTTTGGCGACC
TTTTGTGTGAACAGCCTCTTCCATTTCGCGGTATGTTAGGGTTTTGATCAGTCGGTTAGGGTTTAGTCCAGGGTTGAAGAACCAATTCAAAGAAATGCAA
CGTAAATGCCATTTTCGAATCATTCACACTGGAAGACCACGCGTACGGCTGGTTCTGAGCGCTTACAGCCAATGCGACGCAATCTAAGCGAGCGCCACAC
TATCGGCAGGAACCCGCGGACGGGCACCCTTACGCGCCCGGGACTGCCGCGCCGCTGGTCCAAGGACGACGAGCTCATGCGCACGCCGTCTTCGGCCTAC
GACCAGCTACGTGTGAGCGGCTTCCCGCCCGTGCAGCTCGGCAGTTGGCACCGCTACCGCTCGATCTCACAGGAGTTCGACGACGTGTTCAAGCCCGCCG
CGGCGTCGATTGCACGCGAACCGGCGGTACGTAAGGTCTCCGTTAAATTTACGCCGATTTAACTGATTAATCGGTGGCGGGTGGCTAATTGCTTGCAGAA
ATTCCGCGTGGGTATTGAGATACAGCAAATTCTGAAACCGACGAAGGCTCGGGCGCGAAAGACGAAGATCATATGTGCCATTGGCCCTGCGTCGTGGTCT
GTCGAGATGCTGGGTGAGACTTTGAGTGGGTGGTTTCAATTGATATGCGTGGAGCTCATGTGGGACTTTATAAAATGTAGGACAACTGTTGGATGCGGG