Description :
From Genome Similarity Track
Location :
Scaffold_85:29365- 32272
Transcript NameFunction/comments
Phymu_g38363-hydroxy-3-methylglutaryl-coenzyme A reductase, putative

Sequence
2907 bases(100 bases per row)
GCGACGCCTAggacggagctggacgcggcgctggagcagacgctGATGCTGTTGCGCACAGCTCTCAAAGCCGCGCAGGGCGTGACGCTAGACGAcgcgt
tgcagcagaaagcgacgcaggtggcggcgctggccgCGCAGGTGCAGCGCCGATGCGCGGACGCCGCGAGATCCAAGCGTTTCGAGCCTCTGGAGCCCAG
CCACGACGCCAGTGAGAGCTGGGCCAACAATCCGCCGGTGGAAGCGGCGCCGCAGCCCTCGGTCTGGTCCGGATTCTACAACAAAACTCTGCGCGAGCGA
TTCGACGTGCTGGCGCTCATGTACCCGCGTCTCAAGACGCTCAGGACGCAGCAGACAGGTGGAGAGGCGGTTGCGGATATTCTACCACCCACAGACCCGG
CGGCCAGACTGGGCGAACTGCCGCTGCGCACCGCCAACCTCATGATCGAGAACTGCATCGGCGTTCTGGGTGTCCCGCTCGGTCTCGGCCTCAACTTCGT
CATCGACGGTAAGAGCTTGTCGGTGCCGATGGCTGTTGAGGAGCCTTCGGTGGTAGCGGcggcctccagcgccgccaaactcgtggctgctgccgGCGGT
GGCTTCCACACCGCGACGTCGGGCAACATCATGACGTCGCAGATCCAGCTCGTGGGCACGGAGGACATCCCGGCGGCGATCGCAGCCATTGAATGCAACC
GCGAGCGACTGCTGTCGATTGCCAATACCACACTCTGCCCCAACATGAAGAAACGTGGCGGTGGAGCCGTGGATGTTTACTGCCGCATGGTCAGccaagc
tgctcgatctgcaGCCATTGCGGTTGCCGGTAGCGCCTGGTACACTTCATGCGCCGATGAACTCGTGGTGAACGCCTCCGACCCGCAGACGCAGTTCCTG
GTCGTCCACATTGACGTGGACGTGTGTGAAGCGATGGGCGCCAACATCGTCAACACCGTAGCGGAGGGGCTGTCAGAAGAAGTGTCCAAGATCACCCGTA
GCCGTGTCGGTCTGCGCATTCTCACCAACCTCTGCATGCAGCGCCGAGCTCGGTCTGTGTTCGAGATCCctgtgaagaagctcggctGGAAGGGAGTGGA
CGGCGAAGACGTGGCCAACCGCATCATGGAGGCCTACAACTTCGCCGCTATCGATCCGTACCGCGCTGTGACCAACAACAAGGGGATTATGAACGGCGTG
GACGCCGTTGCAGTGGCCACCGGACAGGACTGGCGAGCCATCGAGTCGGCTGCGCACTGTTACGCCAGTCGTTCAGGGCAATACGCGTCGCTCTCGCACT
ACGAGATCGGCCTTGCCAGTGACGGGTCTGGAACGCGCGTGCTGCGTGGAAGCCTCGAGATGCCCATCGCAGTCGGATCGAAGGGCGGCGCGTTGATGAC
GCACCCTGGTTACACCGCGACCCACGCGATTCTACAGCAGCCGACGGCTCGTAGCCTGAGCGGCATCATCGTGAGTGTTGGGCTGGCTCAAAACTTCGCT
GCAATCCGCGCAATTGCCGTGACAGGGATCCAGAAGGGCCACATGGCTCTCCACGCACGAAAcatcgctgttgctgccggcGCACCTAGCGAACTGGTGT
CGGAAGTTTGCAGCTACATGTTGCTGCGAAAGTCTATCAACGTGGAGACGGCGAAGGAGTACTTGCACGCCCACGCCGTATTTTCGGAGATCCAGAGCAA
CTCGCCTCCAATTTCCCCGGTCTCGATGACGCTGCCTTCCATGTTCTATGTGGAAATCCCCATCCCCGAGCTGGAGGACACAATCAGCCTGAATATTGCC
TTCGAGGCTATCAACAAGCATCCACAGTACATCGCCATCATGGCGTCAAGTGCAAGCAAAGGCGGTCAGACGCTAACGACGTTCCAGAGGCAGTTGCTGG
GCGACAAGGGCTACaaccagctcgagaagatgtTTCGGTTCCTGGCCTCCATGCGTTCCATCGTTATCTCGGCTTCGAGCTCGGAGGGCGATCTGTTGCT
GTCACGCTCCAACATTGGCCTGCAGAACaagctccagttgctgtctATTCTCATTAACATCATTTCTTACCGGCTCATGGAGGTGCGTCCCCAGAAGGTC
CGCACGTTCAtgcggcagcttctggaggCGAGCAGTGGATCTGCAAACGGATCCAACGACGGAGAGATGCACGAGTTGGACGCCAAGTTTTTCCACGATC
TGATGGTGGAGAATGTGGAGCCTGGCGATGAACTGCTGGCGACAGGTTTACCGCTGTTCCTCGCTCTGTGGCAAGTGCTGCACTACCACATCGAGCAGGA
GGTACCTCACAAGCTGCTTCGTGTTCGACTCGTGAAGGAGCAATGGGGGCTGCTGAACGACATCGTACGGAGTTACGAGCTCGGTACGCTTTCCGACGGC
ACCACTGACGcgacgtctgctgctgaccaACCGCTTGAGGAGAAGTTCTTGGAGTACGTCGCAGTGCAAGCTACGCGTTGGCAAgcgacactgctgctgc
tcatcgactcactggtgctggcgtcggagctggtgaCGCCTGAGCGGCTGGACTTCCTCGCTCGCATTGGCGAGTACATGGAGTGGGAAGGCTCCATCGC
GCACGACCTGGCGCGCTACCAACGCGATGCTACTGAGCGCGTACCCAACGCCTATCTCTATTGGCTTTCACAGCGTGGGATCTCTCATTCGGAgggcaag
aagtacgagcgTGAATTCCGCGGCGTGGCCGACGCCTTGGCGGCCGATAAATGGGACAAACTACTGCAGGAAGCGCGACGGGACTCGTGGGCTGCTGCCG
CTTTTTCGTTGCCAGCAGTGGAGCGCGTCATCGGTCTCATCCGCGACATCTACGGCGACCACAGCGGCCGCAGCATCCGGAAAGAGTCGTTCTAAGGTCA
TTTGTTG