Description :
From Genome Similarity Track
Location :
Scaffold_28:29364- 30651
Transcript NameFunction/comments
Physo_133785hypothetical protein

Sequence
1287 bases(100 bases per row)
GCAGTACGGGAACGTCTTGTCACTGACGATGACAGGTCGTGGCCGGTCGTGTACGTCACGTAGCCGCCCAGGCCAGTGCAGATGACGATGGTGAACGAGC
CGATAGCCTTCTCGTACCACGGAATGCGGTTCCAGAACACCTTGAGGTAGAAGACGATGGGCAGGATCATACACGCGAGAGACACAGCCCAGGCTCCGAC
GAAGTCCGAGAAGTCCATGAAGTGGTCCTTGAAAATGATGGCCAGGATGAGCAGAATCACCACAACGCAGATGCGCAGCGTCACGTACTTCATGATCACT
ACGGGTCCGCTGTTGTGGTACTCGTGGAGCAGAGCCTCCGGGGACAGGTCAAACTCAGTGTCGGCCATGGAAGTCACCGAGGGACGGCCAGTAACGTTGG
GCGTGCCTTCCTTCCGGCTCTGAGGGGTGTTGATCACCTCAAAGGCGGGGGATTCTTCGTCCGCAACGGGGAGGAGCGGACGCTTGTGCATGCCCAGCAC
TCCACGCTCGAGAATGTACAGCACGAGGTTCAGGATCACGGACATGGCGATGGTGATGTGCAGCTGCATGAACATGTAGGCAAGCACGACAGCACCGCGG
TTTGCGCTCAGGTTGAGCGCAGTTCCGTTGATGGCGAACAGGAGGTTGACGGGGATCTGGCAGCCGACGTACGAGTACGACGTCTCGCCGATGATGAGGA
AGCAGCAGGCAGCGAAGATCATGGTGCAGGCGACCACGCGGGGCATGCGCTCGGGCTGCGAGTGCTCACGCTGCAGAGCGGGCACCAGCACGGCGGCGGA
GTAGGCCAGAGCCAGGTTGCCGAACGACGACGCGGCCTCGCTGAACTTGATGTCGGGGGTGGGGACGGACGGGTGGTCGTTGCCAATGCCCACGGCGAGC
ACGGCGATGGCAATGGCATCGGCCAGCACCGTGCCCATGCAGCCGGCGAAGGTGGCGTATGCTCCCTCCTTCAGGGTCGGGGTGACGATCACAGGAAGCA
GCATCGCAGCCATGATGATGCTCCAGTATTGCTGGTCGAAGGCGCCGGGGGAGATACCGTCGAGCAGGGTTCCGCCGAGCACGAGGTACGCGCAGGGCAC
GAGGAGGCACACGCCGAACTGCGCGAGCAGCACGAGGTAGCGTCCGATCTTGCCGCAGCACCACTCGCCGACGTCGCCGTAGGTCTTGGCGGTCTTGGGG
GCCGCGAGACACACACGGGAGATAGCGACGCAAGAGCAGACATTGGCGAAGCCCATGAACAGCAGCGCGACCGTGGCGATGGGGGCG