Description :
From Genome Similarity Track
Location :
Scaffold_175:29361- 31083
Transcript NameFunction/comments
g14243.t1hypothetical protein

Sequence
1722 bases(100 bases per row)
CATGATGCCGACGAAGGTGCACTCCTTTGAGGTGGTCCCTCGCGATCACATGATGATACCTGTTGCTACGCCTACTAGAGGATTGGGAACGGCGAAGCGG
ATGCTGCTAGCGGCGTGGGTTGGCGTTGGATTGATCCCTTTCCTTCTTCAGGCACGAAGCTTTCTCAAGTTCGCGACGCCGCACAAAATCAATGAGACTC
TCGTGGCACCGTCTGGCGCCGAAAGGGAGACAGCCAATCTAACGGAACTGTGCCCCGCGACAGGATTTCTCATGGCTCAAACGTGGTGGAATATCGTGGC
AACACACTACTATGAAGTCGAGCATGGGCGGATATGCCACGTCGTGGTACCACAATACAACATGCATGGAGGCTATCGTGTGGGTAGCTTCGACGCTACA
CCATTTCATACGACCCCAGAGAGCTGCATACAGGACAGCTACACGGTGGAACAGTATCTGTATCATGGAAGCTTTGGGTACTACGCGTTTTATGAGGAGG
CGAAAGGCACGTATTGCTCGTTAGACCGAACGGTGTATGCACTCGTTAACGGCGTCGGCACGTACGACATCAACGGTTGGTTTCTGGCCCAAGATGCTGG
AGGCACCGACTCCAGACGATCGTACTGGTACGGCACAGTTGGCACGATGTGGCTAATTTACCGTGCTCTCGTGTTGCGGCGAAGTTACATCTCCTGCAAT
CGCTACGCACGAACGTGTGACGAAATGGGCGAGGTGCTCTGGCGAAAGCCCGCGATGGTTTTTGTGCACGAAAAGATGCGGTTGTCTGCGCATGGCGCGA
ACAACTTTCAGCGACTTGCGCTGCTGTACTTGATAATTGAAGGACTTATGAGCGATTTGTTCCTGTTGATCGCGCACGACGGTATCTTCGCCCAGATGCA
GTACATCTCGATTGGCTACAACTTGTCTGGTTTGTTGCTTCTCCTATGGGAGATTGTCGAGAACGTGGGTTGGCTCAAGGAAAAATGGAGGATGCTGATT
AAGCGATTGCTCTTTAGCTACGAGTCGTCACTTTTGGGGGAGATGCTGAGTGCTGCTGTCCAGCAACACTTTCTCGTGTCCTTGAATCGATCTGATTTGA
AGGAGTCGAAACCAACCGCCCTTGCAGTGTCCTATTACGTGTGGAGTCTTTTGTGGCATACCGTGTACGTGATGATGTTGATTGGGTTCATCATGTCCGT
ACGGATATCGTGGGCGACTGTATACGTACTAACAAGAAATCGTACATTAACTATCTTCACGAGGCCATGCTGCGTCGATACTGTGCTAGGCGCACGATGT
AGAATGACAATGCTTGGCAGCTATCGTTTGGAAGGAGACCAGCTCTTTTACAAGGCAGAAGCACTGAAAGCTTTCGGCGTCTTCAAGGCCGAGGAAGGCG
ATGGCTCCGAATGTCTCGTTTTGAACAAACTGGACTGGATTTCGGTCCCAGCGGACAACTTGGTCGTCATTGGAACTGTGTTGGGGCGAAGATGTGTGAA
GCTGTGTCCTGAGCGTCCTTGTACCGGTGTCGTGAGCTTTTTCAGCACAAATTTGGGGGGCGCCCCTGGAAGCGAGCGCGCTTTGTATGCCCGCAGAACC
TCACAAGTTGCGGCCAGTCCACCTCCAGCGGGAGTTTTACCAGCCTGTTGAAGTCCGAGAAGACTGGTAATAGCTAAAAACTAATTCGTGGGCTCCGGCG
GTTATTGTGTCCGGCCCAATTG