Description :
From Genome Similarity Track
Location :
Scaffold_437:2936- 4708
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_437-fgenesh-gene-0.0Copper-transporting ATPase

Sequence
1772 bases(100 bases per row)
TCGTGCTCATCGGCAAGTACCTCGAGGCGGTCGCCAAGGGCAAGACTTCCGAGGCGTTGGGCAAGCTGATGGAGTTGCAGGTCAAGTCTGCTACACTGCT
CGTGTTCAACGCGGACGCAAGCAAAGTCGTTGAGGAGAAGCTGGTGTCCATTGACTTGGTGCAGCGTGGCGACATTTTGAAGGTTGTCCGTGGTTCATCT
ATTCCTGCGGATGGCGTGGTCGTCTTTGGCGAAGGTCGTGTGGATGAGTCGATGCTTACGGGCGAGTCGAAGGCTATCAAGAAGAACCCCGGCGACCGCG
TGCTTGGTGCGACAGTCAACACGGAAGGACTCTTCCACATGAAGGTAACTGGCGTGGACAGCGACACGGCGTTGAGTCAGATCATCCGTCTGGTTGAAGA
TGCGCAGACGTCCAAGGCGCCGATCCAAGCGTACGCGGACTATATCGCGTCCATCTTCGTGCCGACTGTGCTGGTGCTCTCGGTTGTGACCTTCCTTGTG
TGGTACGTGCTCTGCGTCACCGGAGTCGTGCCGTCGAGCTGGGTGCCAACGACCGACAGTCTGTTCGTTTTCGCCTTCAACTTTGGCATCGCGACTCTGG
TGGTGGCGTGTCCGTGCGCTCTCGGGTTGGCGACTCCCACTGCCGTCATGGTCGGCACTGGTGTTGGAGCTGAGCAAGGCGTCCTGATCAAGGGCGGCGA
GCCTCTCGAGGCAGCACACAACATTGACACGATCCTGTTCGACAAGACTGGCACGCTGACAGTCGGACAGCCTGTGGTGACGGATGTGATGGTCTTGAAC
AAGAAACTCTCGACCGAAGAGCTGATCACACTGGCCGGATCGGCGGAGCTCGGCAGCGAGCATCCGCTTGGACGTGCCATCATAGAGTACGCCAAGTTTA
TCTCTCCGTCTCTCGAGCAACCGGCCGACTTCAAGGGTGTGTCGGGTCGTGGGATCATGTGCACTGTTGGCGAGCGCAAAGTGGTGATCGGCAACAAGGA
ATGGATGCGCGAAAACGCACTGACTCGACTGGATAGCATTACTGTCGACCAGGCGACTGTCACATTCCAGAATGCCGGCAAGACGCCGGTGTATCTCGGC
GTTGACGGCGAGCTGAGCGCTGTGTTTGGCATTGCTGACGCTCCTCGGGCCGAGTCGGTGCGCGCGATCAAGAAGCTCAAGCAGATGGGTCTGGATGTGT
GGATGGTCACTGGCGACAACAGGCGGACGGCGTTCAGCATCGCGGATCAGCTCGGGATCAAGCGTCGCAACGTAATGGCTGAGGTGGTGCCATCTGAGAA
GGCGTCGAAGGTCAAGCAGCTGCAGAGCCATGGACGCCGCGTGGCCATGGTGGGCGACGGCATCAATGACTCGCCGGCGCTGGCGCAGGCTGACCTGGGC
ATTGCGATCGGCGGCGGCACCGAGATCGCAGTCGAGACGGCGGGGATGGTGCTCATGAAGTCCAGCTTGTGGGACGTGATCACGGCGCTGGATCTGTCGC
GCACAATCTTCAACCGCATCCGGCTCAACTACGTGTGGGCTCTCGGATACAACTGCTTACTCATTCCGCTGGCCGCTGGCGTGCTCTACCCGATCGGCTA
CAGCATTCCTCCCATGTTTGCTGGCGGCGCGATGGCCCTGTCGTCAGTCTCGGTCGTGACATCCTCGCTCCTGCTTCGACACTATAAGGCGCCTGAGCTG
CCGCCGGACCTCGGCAGCAGCGACATCAAGTCTCTGCTATTCAAGAACCCAGGCGAGTCGACGCCTCTGCTG