Description :
From Genome Similarity Track
Location :
Scaffold_1474:2936- 4442
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1474-fgenesh-gene-0.240S ribosomal protein S18
Pytiw_DAOMBR242034maker-piw_contig_1474-snap-gene-0.11Conserved gene of unknown function

Sequence
1506 bases(100 bases per row)
TCGTACCTGTTTCCAACCAGCCTGCAGCGAGCGCATGCCATCGTAGAAGAAGCCAATATGTCAATGTGTCTGCGGAAGACTCGGTTTCGCTAACTGTATT
GTGATTGTGATGTTGTTGTTGCTGTGCAGTCGCTTGTCATCGGACCAGATTTCCAACACATTCTTCGTATTCTCAACACCAACGTTGATGGTCGCCGCAA
GGTCTGGGTCGCTCTGACCGCCATCCAGGGTGTGGGACGTCGTTTCGCCATCATGCTCTGCAAGAAGGCCGAAGTCGACATCACCAAGCGGTATGTACAC
AGTCACAGCGAACCCGCACATCTAGCTGTCATGATCACCATTGAAACTAATCTATTGCTCCATGTATTATGTCTGCCTTCAGTGCCGGTGAGCTGTCCAA
CGACGAGATCGAGCGCATCGTTGCCATCATCCAGAACCCTCTCCAGTTCAAGATCCCAGTGTGGTTCCTGAACCGAAAGAAGGACTACAAGACGGGCAAG
CACTCGCAGGTTGTGGCTAACAACCTCCAGGGCAAGCTCCGCGAGGACCTCGAGCGCCTCAAGAAGATCTACGCTCACCGTGGTCTTCGTCACTGGTGGG
GACTCAAGGTGCGTGGCCAGCACACCTGTACCACGGGCCGCCGCGGCCGCACCGTCGGCATCCTCGACAAGAAGTAAGTTGGCTCGCCCCACTTACTGCG
CTTATCGACGACATCCGACCGGGTTCAATAGTGAGAATTGCTGGAATGCTGGGATTATTTTGGTGGTTTGCCTGCTTCTGGTCCTCTCACCGGGGTGACT
TCTAAAGCAAATAAACAGTTGCTGCTTCAACAGAGCCCTCCCCTTTGTCTTGTCATCTCTCGTTTGAGTTTGTTGGTTGCTGCCTCTTGGAATCGTTCGT
CCCTGAATCTATCAGTTGATCCACCAAACAGAGAGCCCACTTGTTGCCTGGACTCATCAATCCATTCCTGAAGCACTTGTGACTTTTCTGCTGCTGGGGC
TTTGTTCAAATGGGTTGAAAGACACTTCCCAGACTGAGATCCCACACAACACTGACGCCAAGTGCTGCTGGCAAGAGCACCTCTGATACGTCAAAGACTC
CCAGAGGACCAGGTGAAGCCGCTCCGATTCGGCACTTGATACCTTCGACAGCAGCTCTATAGGCTCATGACCGAACCGCATTTGCCAGCCTAGCGGCGTT
GGGAACACTGTTGAAGGGTAGCCAGGCTCCAGTTTGTCTCTGTACTTTCAGAGTCAAGCACGACCAGGTAGCAGACTCACATCTCACTCTTTTCATATTC
ATATTCATATAATATCCAGCAAAATCAAGTCTACTCTATGTGATGCAGAGCGAGCGGAAGCCGCCAATGCCGATCTCAAAGATGCGCTGCACGCCCAGTA
CGCCCATGATGGCGCCGCTCACGCCCACGACGCCCGCGATGAGCAGGATCACGAACGCCGTCTTGCGGTACTTGCGGATGAGGTAGCCCATGCCGAGCTG
GCCCAC