Description :
From Genome Similarity Track
Location :
scaffold_10:29353- 46117
Transcript NameFunction/comments
g639.t1 hypothetical protein PHYSODRAFT_506421
g640.t1 conserved hypothetical protein
g641.t1 hypothetical protein PHYSODRAFT_508787
g642.t1hypothetical protein
g643.t1hypothetical protein

Sequence
16764 bases(100 bases per row)
CGACGTGCCAAAAGCTTTCGCTTGCGCCACCACGTTTGGATGGTCGTAGCGTACGCGTTATTCCACATGCTCGTTAAGATTTCTTGGCGGCGCTGGTCCT
CCAAATGCACTTTCAACTCGTAGAATTGGGCCCGTGCTCGCTTAGCTCGATACGCGTTCTGTAGCAATGTAGCGGCGGCAGTTTTCGTCTTTAAAGTGCT
TTCCACGCGAAGTCCAAAGCAGCGTAAGAACCGAGCGTACCGGAAAAACTTAATTAACACCCGCCTCGCCTTGATTTGTCTCTCGCTCTTCGCTTTGGCT
CTTGCAATCCGCCTTCTTGTGTGTCGAATCCAAAGCTGAATGGAGATTGCAGCATGGTACCTTGCCAAGTGATGACACCAAGCGAGGATATCCCGCTTTC
TTTCGATGTACCGCACAAAAGTCCGTGTGACCACTCGTGCTGCTTGTTGCTGCTTCATCCAAACTGCACAGCGCACTCGGAAAAGGTATGAGTGGTAAAA
TCTCTGGACTTGGTGAGCGGCCTCATTATACGCTATGAAGCGCTTCTTTCGCTTGAACAGTCTTTTTAATTGAAATCCTCGCCACTTGGCTTGGATCAGT
GTCGCGGCTTGGTGGAGGTGATGTACTGCTGCTGCTTGTTTCCCTTTCACTCCGCGTATCCAACTTTGAATGGCAACTGCTGCAGCAATAGCTTCGCTCT
CGCGCTGACCAACTACGTCTGACATCCACCGACCCCACAACCGGAAGATTGTGCACTCCAACCTTTTTCGCGATCTCTGAAGGATCCATAGCGCACATTT
TCTAGAGTTGAAAATTAGAACATAAAAACATTAGCCATGCTCATTTAGTAAGGGAAACATCCATAACACACAGGCGGCAAAACGTTTGGATCTGTTGGAG
GGACTGCAACCATTTTGTTTGCTGGCGCCATTGAGCAAACCGTCGATGTTTAGCACGTTGGCAATATCTGGACATGACGATCTGGGAACAAAAAAGTAAA
GTAAGATCGTCGATGAAAGTTCAAATCGTGCGTCAATGGTGTTCGTACCGACAGTTTGTCAGCTGCAAACCGCTTTCTCATTGTTGCGGACCGGTAAATC
TCTTCAATGCAATTATTGCGGACCCATTCTCGTATTTTGAGTGGGCAACCTGGTGCGCGAGGACGATCAATCGGAACTCTTGCTTGTTTTTGCGGTTTTG
CTCGATTTGAAGTGCGGGATGGTGTTCGTGTAGTCACTATCACCTGTGGAAGCACAGCCCTCGAAGGGGGTGATAATCGGCCATGAATCCACGCATTTTG
CGCAAGTCTATCACATAACGAAGTTGTCGATACTTTTGAAGAATGGCTATAAACCCACTCGTCTTGCCGACGGAGCATGACGAGAGCCGTCTCCAGCTCC
ATGACTTGATCGTACGATAGATCTAATTCTCGCAGAAAGCTCGCACTTTCTACAGTACTAGCCACCTTTGGATGTACAAGCAAGAACAGAATGTCTTCTA
AATCCAGGCATTTCAAGCGAAATTTGTCCTCCCAGAGTGTAAGTGCATGCCCCCGAAGGCGAAAGCGGTCTGTTGGAGTTCGTGCGCTCGGGTGTTGATT
AGTAGCTGCATCAGCTCTTGATGAAGACCATGAAGGTTCCAAGTTTCCTCGTAGTCGTCCAACAGATTTATTCAGTTTGCAGCATTTGCTATCAGGAACA
TCCCTTGTTTTCCGCCTTTTGCCGTCAACAGAACTCAGTTTTGGTAGGCTGGGCGTCAGCAAGGAGCGTGCCTCACAAAGATTCCTTTGTTCTGGCAAAA
CCTCATTTAAAATGCTTGCCACACTCCATTTCATCCCGTTCGTCCAAGCAGCTAGGCGCTCCATCAGGTCCACGAATCCTACGGTAGCCAGAAATACGCA
TCAGTTCACTCCCCCAGCACGTTCCTTCATCAACAACATTTTGTTACCTTCATCAATTGCCCTGAAATTAGCTTCTCGTTTCTGCGTCGATCGATGCACC
CCATGCACCTGCTAATTTTGGGAGCGTATTTACTCCAACTCGACGCGCAAGTTTAGCTCCTTTGCCTCCATGAACGTAAGAAGTTCCTGGCATTCTTCTT
CACTCAAGTAGGCACGCATTATACGAATCCCTTCCATGTATAGTTCCTTGCTCCACGCACAAGCAGCAATTCCTCGGTAAAGTACCTTCTTCGCGGCATC
CACCTTCCCTAGTGCGACTTCGAAGTGCATGTATAGCCGCCAGCAAAGCGCGCTTCCTTTTGTCCGAATTTGAGTAGCCATCTTTTCAAACAAGCGACGG
ATACGAGAAACTGCAGTCGCATTCATTCCCCAGCGATGAAAGAGGCAGCATTTAGGGCGAGAAGATTTGTCGATGCTGGACTCTGTGTTCATTGACAACT
CCATTAGCGTAGCGGCCCTCTCGGTACGACAAAATTCACAGAGCAATGCAAATAACCACTCCACCAATTCCGGCGAATCGTAATGCCGCCGCCATCGTTT
CTCGACTCGAAAAAAGTAGTTGCGGAGCACCTGTGAAATAGTGTTCCCCGTCTCAGAATCGATAAAGAGTCGTAGAAATAGCTGGTTGCTCGGATGCATC
GTCACTGCCTCGCCCACAGCCGATCGCCATACACGAGGAGCAAGTGCGGGGAATAAGCCCGAGACTTGATGTTGCTGCATGAAGTCTAGGAAGCAAGTCC
ACACCCATAAAACATGCGCGCAGTTCTTATGCTCTTCAGCAGCCAGGGCTTGTCGATACTCGTGACAAGCTGCGTCAAATCCATCATAGGCGTACACTAC
GAGCGCTAAGTTGTGCAAGCAGTAACCAATCCAGCAGATCGATCGGAAGGGTGGTTGGATGCTTTCATTGCAACGCCCACGACTTCGTGACGTCGATTCT
GTACAATGATGAACGGCAAAGCCGAGCTCGGTACGATATCTTGCAATAAGATCGGCTTTCGTCCACGGATCCGACATCAAGAGTTCCTTCAAGTAATCGC
TAGATCGCTTCCGGTGTTTCTTCATAATTGTCTCCAACGTTTCCTTCTTCTCGTCACCAAATTCCCCAGGTTGCAATGCAGCCCACAGCGTATACAAACA
CCGCAATGTCCGGAGCTTCCCTTTGGCTCGATCCTTCGCTTCGCCACCAGAGGATTGCCACATCTCAAGACGAGAACGAAGAAATACAAACCGGTGAAAA
GTTCTCCCTTGAATCGCATCGTGTGGAGAGGGAAGGCCAAGTGACTTGAGCGTATTGTCACAGATACGTCTGACGTGCCGGTCATTTCCGAGACTAAGTT
CCAACTTGGCATAGGAATACAGTGCATTGAAGTCTGTACTGCTGTCGGTGTCTTTCCGAGCTAATTGTTGACTCAAATGTCGAACATACGCCAGACTTTC
CTCTGAAACACCGACAGTACGCGTAACTTCAGCATCAAATCCAATCCACAAGCTTTTTAGTGCACTCTCAAACTCTGCAGCAGTTTTGGCGAAGATATCC
AATGCCTGCGCGAATACTCGACGAATATACTCCACCTTACTGGGATCTCGGAGCACATCTTGCTTCACTGAAATGTCTTGAAGAAGAGCATCCTCGAGAA
GCACCTTCCGGTCACATGGATCAAGAAATAATTTATTCTTGTTGGAGTTGCCTGAATGAGGGTCAAGCACAAAAAGGATCGGAGCCACGAGCAGTTGGTA
GTCTTCAGGGCAATCCGCGTACATTGATTCGCCAACCGGAAAACTGGTTTCCCATGAATATTCGCCTTGCCATTCGACACCACATATCTGCAACAGCTCG
GCAATAACCCGCCATTGATCTGCCATGGGAACAGGAAACAAAAATGGCTGGACTTCTTCCGTGAGAATGGCGCGATCCGGTTGCTGCTCGATGAGGTCTT
GGTGCAGAGGGTTATTGGAGTGCAGCGGGGCCCATTGCATCTCTGTTTGCTCTTCTTCTCGCATAAGCCAACGTAGAAAGCGGTCATCTTCGTCAATCGG
ATCATAATTCGCACGCTGATCCTCAATCTGAGCCTTTGTCACTACAAGTACTGCCCGTTTCATCATCTCCTTTTTGAGCTGTCGGTTTTGTCGAGCGTGA
GCACTTTCGGTGCCGCGCAGCTCTCCAAGGATGCGTTCATAATTCCCAGAGTCGTCAGCTTCGTCGATGCTAATACGATATCCGTGCAAGTTGCTGTAGA
TAACTTTACCGCCACGCTTCGACTCTTCTTCCGAACTGTCACCAAACGAGGAGTTTTCATTCAAAACGGTGATGCCGTCTTTGCCATCCAAAGTACGTGA
TCCACGTTTTATACGTGAACGGCGCTGGTATGCTGCAGAAGCGGACAAGAGGCTCTGCTTATGCCCTTCAGTACGCAACACTTCAGAAGGATTTACTTTG
CCAGCAGAAGTAACCTTTTCCTGGATGTAGTGTCGAAATTCAGCAGCAGACAGCCTAGGGGCTTGTTTTCCCAGCATTTCAGTGCTCGCGCCAACATTAC
CTCGATCTTCTCCAATTCCGTTGCAGTCTTTTTCATTCCACCGTAAAGAAAACTTTCGCAGCATTTCCAAGTAAAGACCATTGCCACTACCTCCCGTAAT
CGTAGATCCTTCGTTCCGACTAAAATCAAGTAGAGCTTGCAATTGAGCTATCGCACGCTCAATAAAGCCCGCCTTCTTTTCAAACTGGCACATAAGAAAG
TGGAAATCCAGGAGCGCTATTGACGCATCTTCCGCTACAGTTCCGCTTGAGGATGGACTTGAAGGCGACCGTTTAGCCATCGCTGCTGTAGCACTCGTGC
TTTCTTCTCTTAGTACAGCAAGAATGCGTGCGTAGAGGTCGCGCACAGACTGCATCGAAAAGCTTCCGAAGTGCTGCTGGCGGCTTAGAAGAAGTTTAAG
CCAGAGCTCTCTGTTCGTACAGTCTTCAGATAGGAGGGTCTCAAGTTGCTGCAGAAAATCAGTGCTGCTGCCTCTTTCTCGCGACAACAACGACATGTTC
AGCTTGACGCGATGCAGCTCCCGTGACTGAGGATTACTTACTAGCGCTTTTGCAAGAATCGCAACTTGCTTTTCCACAACACTTGCGTTCATCGCTGAAC
TCGACTTGGACGTTTTAGTGTGAAGTCGTATTGTCTGCTCTTGGAAGACCATCAAGTCGAGCCAATTATCAATGTCATGTGGATTTGCTGTAACAGCAGC
ATTGAGTGCTTTGCTGCGTTCCACCAGGTGTTGCTCAACGTTTTGTCCGTCAGATAGCAGAACTCCATGGGTGACATCATTTTCGTCTGGGTAATTATTG
CTCTCCGCACTCGTAGTACGGCCCTGAAGCTCGTCACCATCAAGAACTGGATCCAGAGGAATAAAATCCATTTCAGTTTGACGGCTGCAGACAGCGCTAA
CATCGCGATTTGTTTTGCTATCAGTGCGAGACAGCCTTTTGTTGGAGTAGGCGAGATAAAGTCGCCTTTGTCGACCATCTCGCTCCAGTTTGCGTGCCAT
CAATGAGAAATATCGACTCGAGTCTGGTTGATCCTTTTTCTTGCCTGGAATCTCGCTGGTGGTGAATTGTGGCCGTGCTGGGGGCAGCTTTGCCCCGGTC
AGAAGGCTCCGCCGTGTAGCCAACTTGTACAGTGGCTGGTCATGGGTGTACATGGATCCAAAGAACTGATTCTCGCGATCACCAACGCGATCGAATTCAA
AAATCTTCTTGTCATCTGCTCCTTCCTTTTGGTCGTGAACCACAACGTCCGCTGTTGCCAGCTTCACGATCCTAGCTTCAGCCCTGTAGCTGAGTGATGG
TGACTTTGATCTGGAGCGCGACTTGCTGTGGCTTCGGCGCCGATGCCGTCGATATCGACGTCTAGAACGCGCCCTGTCTTCGCTGTCGTTGCTGCTATCG
GAACGACTCTGCGACCTCCGCCGCTTCTTGCTCTTGTTCGTCCTCTTATCGAGATGTCGACTCTTCGTCTCCTCACCGTGCCGCTTTTTCGCCTTGTGTC
GTTTCTTCTCTTTTTTGTGGCGATGCTTGTAAGCTTGTAATGCCGTGTTGTCGCCTGGTACACCTTGCTTCGCTTTATCGTCGCTTTTGGTGCCAGTAAA
ACTCTTGCCAACGCTCAACCAATCTATTCCACAAAGTCGCGCGTGGTTAGTAGAGTAATCTGGACACACACTAACAGTCTGTCCATCTGCGTACCTTCAG
CACTGCCTTCGGCGTCGGAAGCGAAGCCCTGCGCTGCTGCATCCCGCCCTGATGCGAACATAACGCAAATTAAGGGCCATATTGGGACTATAAATTTAGT
GATGACTTTATTAAATATAGTCTAAACTTTAGTCCTGCAATATAGTCCCAGCACACATTAGCATTCAGCAAACATGAGTGGGGAGAAGCTCGCTATGCAG
ACGCCACCCGTGGATCTGACGAACGAGGAGGAGGTATCATCTTACATCAAGGCAAAGATCCGAGTGTATAGCAACTTCCCCAAGCCTGGCGTGGATTTCA
GCGATGTCACTTCACTGCTACTGGACCCCGTCGCCTTCCAAGTGGCCATTGACGCACTCAAATTGCGCTATCTGGACCAGGGCATCACGCACGTAGTGAG
CACCGAGTCGAGAGGATTTATCTTCGGGGCGCCATTGGCGCTAGCTCTCCAGGCCGCTTTCGTGCCGGTTCGTCGTGCCCGGAGACTGCCTGGAGATGTC
GTTGGCGTGGACTACGTGTCGGGCTTTTACAGGGGTCGGATGGAAATTCACGAGGACGCCATCACGAGCGGAGGACGCGTTGTCATTATCGATGATCTAG
TTGCATCGGTGCGGCAGCTTATAATATTTTCAGTAGTCGCAACAAAACTCACTTTGCTATCGGCTGTCGTCTGTTGTACAGGGCAAAACGCTCAAGGTGA
CGGTCGAGCTTGTTGAGAAGCTCGGTGGAGAGGTTGTAGAGTGCGGCTGCGTGATCAACTCGCTCCATTTGACGGTACGGCTGTCTTCTGACTATTGAAT
GATTTGTGGTGCCGCTTCCACTGCCGAGAACTGACCAGTGTACTGTAATGCCATCCAGGAATCGCTACCGAATGTCCCGTTGTATGGCCTCACCAAGCTG
TGAATAGAGTGCTTCGTTTTCTCCAGAGTTGCGTTTTCTAATCCCTTTGAAACCGAATCTCTAAATACTGTTTACTGTTATATTCTGTCTACTTACTACT
TGCACTATGCACATATAAAGCTTAACCAACGCAACTTTATCGTGGGCGCATCCTTTCAAAACGAATAATATAAGTAATCACAAAAAGAAGTTTTGGATGT
TTCTGGCGCTTCAGACCTGGAATCAAAAAACGAAAAAACCGCGAAGGAGGAAGCGACCTGCAGCATGTCGCCCAAGCCGCGAATCCGCCAGCGCTTCGGG
CCCAGCCAGGACTATCTGCTAGTTGTGCAGGTTAACACGGACCTGCCGTTCCGCGCCCCTTACGGCGGGCTCATGGCCGGCTGGGAGAAGGTCGCCACAA
CTCTTAACGGAAGCAGCGCCTTCAAGATGCACCACTTGAAGGGCCCCATCGCCAAGAACCGCTTCGAGCGCCTTGTGGCGCGCCATCGTAACTGGGTCAA
GAATGGTAGCCACCCGGACGACGTGCCGTCGCAGGACGAGGCCTACCAGAAAGTCATGGCCGAGGTGGTACCCAAACTGGATGCTGCCGAGGCGGATCCG
CAGTCCCAAAAGCTGGGAAAGCGTGGCCGGCCCCGAAAGATCAAGTCGGAGGACGGAGAGGCACCTGTCGAGAAGAAGCCGACGCTGGGAACAGCACAGG
TGACCATTGCTCCGTCGCCTATGGGGCCACAGCCGTCGACATCGTCCACTTCGCTCCTTGTGGATTCTGAGGACCAGGCGTTGCCTGCCGCCAACAAGGC
CACACGTCAACGGTTCACTCATGCAGATGACCTCTTGCTCGTAAAGTACGTGAAGCAGGTGCTTCCGTTCCGTGCCAAGTTCGGCGCGATCTCGGCAGCG
TGGGAGGATGTGGCGTACAAGCTGGACAGTAGCCCAGAGTTCTCCAAGGACAACGTCAAGGGCCCCATCGTACGCTACCGTTTTGAAAACCTCATGGCCA
AGTACCGTGAACGCGTTAAACTCAACAACGGTAGTGTTGTAGGACCAAAGGGTGCTCCTGCAGGCGAACTTGAAGTGCTCATGACGGAACTTGTGACGCT
CTACGACGGTGGAGATCCAGTCAGCGCTGCTCTACTTGCTCAGAACGTGGCGATCGCTACTGGTGCAGTCAATGCCGTGGCAGCACGGAATGCTTCTCGC
GCATCGTCGAATCAAGATGAGGACGAGGTTTCAACCAGTAGCACGCCAAGCGAACCGCTGTCACCGGTCGGCAACTCCTCTGGAGTGGCCTCATCCTCGA
CCCAGAGCTTCATCGCTCCGACAGCTAGGCCGGTGGTGGCTTCAGCATCAACGAGTTCAGCAGTGGCATTGGCTGGCACAGATCCTACCAGTATTGCCGA
GCTGAAGGCGCTGCTCCAGGAAATGGTGGAGCAACAGTCGCGGGCCACGGAGCAAATGATGCTGCTGCAACGCGAAGAGCGTCGCTTGGAAGCGGAACGA
CGAGAGCGGGAGCTGGAGCGTGAGCGTGGAGAGCGCGAGAAGGACCGTCAAGCCTTGACCTCCGCTGTGATCTCGGTCATGGAGACATTCCTCGAGCAGA
ACGGCCACAAGGACTGAGAAGAGTTTGTAGTTGATATAAGGGTGCTATTCTTTTAGCAACATCTCTGTAGTACACGATCGAGTGAGTATCGCTCGCATCC
TTTAAAACGCTATCGAGGATTTATAGCAGCACAGTACCGGTATCCGGCATCGGGCACCTCCTCAATATCGCTGACAGTACAGTAGCAGCTGACGATTTGC
TAGCATTTTTGCGTCCCGGCCCAGCTGGCATCATCTTTCCCTCTTCATGCCACACTTCCGAAGAACGTATCTAATCACATAGAGAACAATGTCCGAGAAC
GCTGGCTCATGCTTTGCCGGTAGTTGCTGCGCGGCGTGCTGCGCCAGCGGAGGCACCTCTGGGAATGACAGCAACCGCCGACGCCTTGCAGACGATGACC
CTCGCCGCCGCGACTACGATACTTCGCGTGATGTGACCGTGCAGCCCGTGGTGATGTCCCAGATCCGCCCGCCGCAGCCCCAAGTACGCGCGAATTCCTA
AACATGAGGCGGAAAAGAGAGAGGCCCAGAATGTATTGCCAGCTCCTTCGGGGTAACATGCACATGTAATTCGCAAAGAGCAACTTGAATATCGGTTCAT
AGTGTCGCTGCGAACCAAGAAACGAGAGCTGCACGTGTGGATAATGAATAAATTGCATTGCCAGTAGCGGATGGGGCGTCACAAACGCACTCGAATGCTG
CCGGTGGATTATGATACGTTTGAACGTGGGTAAATTACCCGCGTATTGATGTGCTCGTTCTGAGACACAACGACCAAATACAATTGTCAAGAGTGCGCTC
GTCGCAAAAGGATCCAAGTGCTCCTTGCCAGAGCTCTCCTGTTCATACTCTCATTGCAACAATTACCGGTGGAGTAACAAACGAAAGCTCGACAAGTGAG
CGACCCAGTGAAGGTAGAGAGACCAAAGCAACCATGTGCGGACCTGATGACGGTTGCGGAGACGAGTGCTGCGGGTGCTTGGCTGGTTTGTGCTGTGCCT
CTTGTTGTCTAGCGGGCGCTTCGGCAACAGACAACGATCGTCGTGATCGTCGCGGTTGCGACTCACCTCCTCCAAGGGAAGTGTACGTCCAACCGGTGGT
CGTGCAGCAAGGTTATGATCATCCGCCACCACCAGGGTATGGTCCTCCACCCCCAGGATATGGCCCTCCTCCACCTCCAGGATACGGACCACCGCCTCCA
CCACGCCGTGACTACTACTAACTTGCGAAGGCGTGGGCAGACACTGATGAAGAACGTGCAAGAAACTGTCGTGTATTCCCTCCACGTAAGCGCTATAGCA
CGAGAAAAACTTAATGAACGCCCTTTTTGGTATTGTCCGAGATGTTCATGGTGTCATCACAAGATACATTGCCTTTCTGCTCGTGTAGGGCTTAGCACGA
ATCGATCATCACTTGACACTAAGTTACACCTCAAGATCATGTTGAAGTGGTGGTCTCAGATTTTGGAATCAGAACGTTCAGAACTGAGGAGAATCAAGCA
AAAATGGGAGGGGAGACCGTAGTCGGCACGCGACTACATTGGCACAGCCATTCGCAGCGCGACCGCATCGACGTCGACAAGGTGCTGGACCAAGTGCGTG
CGTTTTGCACTCGCGCAGCCACGTATTCGAATGGCGGGATCCTGATTGCAGTGGGGTTGCCCGAGGCGATAGCTGACTCCTTCATCTCTCGTTCGTCGGA
CGGAGATGCACCTTCGTCCACTGCGTTTATCGATTCTGTGCGCGAGTTCATGGTAAAGTTACAGGGAGAGGTCAATGCAGGGACTCTAGCCGGCAGGGTG
GAGATCGTCCCGATACTGCATTGGGGCAAATTCGTGCCGGCCTTGAACGCGTTGATCGGAACGGCGGCCGACCACTTCCCCGATGCTGATACACTGATTC
TGCAGTCATTGGAAATCGACGTGAATGCAGCTAGTGTGGAAGCTCTACGCTCGCATTTTGACCTCAAGCATGACCTGGTGGTGGGCGCAGCACTACCTGG
TCACGATTTCCAGCCGAACTCAGCTAGCCAACCAGTCGAATTGACAGGCCTGACGTCGCCTTGGAACACACTGGCGCTCTGGAATCTGGATCAACTGACG
AAGGTGGGGGTTGCACTCATGGGAGACGCGTTACGTCTTGAGGTCGACGGGATTGGCTCCGCTGCGGGTATCGAAGAAGTCGCCACTATCGCCATGTACC
AGCAGCTCTACGCAAACGGCACATCACCTACGATTGCCAAGTTGGTGCGGGTGCCTAGTATTGCGTGGCAACTGGACGGACTGCAAGACCCAAAGCGGCT
CGAGTGGCACCAGAAGAAAATGGCGAGCAAGCAACAGCGCGCCGCCGCCCAGATCGCCCACTTCGGCGGTGTGGCTCCTGGCCGCGTTTATCATTTGGAG
GCGTGAAGTGGGAAGATATGAGCTCTCATCAAAACAAGCTTCCTCGGGAGGATTCAGCTACATGTATCCGATATAGGCAAACATCCAAGTAACGAATGAA
ACTTTGCGTGAACTTGAGCAGGTCCGTTTCTGAATCTGATACCGCACGATGTGACACAGTCACTTCCAAGCAGCGACGCAAAGCAAACATGCGTGGCACG
ACGGTGGTTGGCACGAGGTTGCACTGGCAGAGCCACACGCAGTATGAGCGGATCGACGTGGAGAAGTTGCTGCGTCAGTTGCGCGAGTTCTGCGCGCGTG
CAGCGACGTATGCTGACGGTGGCATTCTCATCGCCGTGGGGCTTCCAGCCGCAGGAGCGACGTTGGCGCCTGTCTCGGGCGCTGATGAGATCTCGCCTAC
CTCTTCCAAGGCCTCGAGTGTCTTCGTTGACTCGGTGCGCGAGTTCATGACAAGATTGCAGAACGAAGTAGCCACGGGAGCTATCGCAGGCAAGGTGGAG
ATCATCCCGATGCTGTTCTGGGGAAAGTTTGTGCCGGCGTTGAATGCTCTCATTGGTACAGCAGCCGATCATTATCCAAGTGCTGACACGCTGCTACTCC
AGTCTCTAGAAGTTGAGGTGGATGCTGCTGGAGTGGCGTTGCTACGCTCGAACCTCGATCTGGAGCATGATCTTGTAGTGGGCACGGCGCTACCTGGACA
CACTTTCCAGCCTGATCCAGCTCTCCAGCCGTTGGAATTGAGTGGTTTGACGTCACCTTGGAATACGCTGGCACTCTGGAATTTGAAGCAATTGACGAAG
ATCGGCTTTGCTCTAATGGGAGACGCGTTGCGTCTGGAAGTCGACGGTGTCGGTCCTGCTGGCGGAGACGAAGAGGTCTCGACGATCTCAATGTACCAGC
AGCTTTTTGCGGACACAGCAGCTCCTACAAGGGCGAAGCTTCTTCGAGTGCCTGGTGTCATTTGGCAGGTGGCCGATTTCAAGGATCCCGAGCGCGTAGC
GTGGCATAGTCGAAAAATGCGGAGCAAGAAGCAGCGCACCGCAGCACAAATGGCGCAGTTCGGTGGCGTGGCTCCAGGCCACGTATACCACATAGATCCT
TCACCTCGAAATGGCAACTCAAAGTAATGAGATGCTAGACGCAATGCCTAACGATAAACAGAAGAACAACTCGATAAAAAAAACATTCTCCTCTTTGATC
TCTTTTGGCTGACCCTTGTGATAACGCCGATCTGCGACACGCCTTAGGCATCCGGTAAACTACCGGTATCCAGTCTTGAAGCCAAAGGTTTCCAGCGACA
GACGACGTTACGGCGCCGGGCGGCGAATGAACTCGGGCGATGGCATCCAAGCGCGCGCAGCTTCTCTGCGCCAAGAAGCGACTCGGCGGTGGCTCGTGAA
GGACGAGCTGGTGTTCCTGCTGCAGCATTACAAGTCGGTGGGCGTACCGGTGGCTCAAGCGCTGCAGTTGCGGCCGACAAGTAGGTGTCGGCGTCGCCTG
GTCGTGCATCAGCGCTAAAACGGCACTAACGCTCTCTCTTGTGCTTGATAGGCGGCACCTTGCTGTTCTATAATACGCAGGAGGTCTTGGACTACAAGAA
GGACGGATGGTTCTGGCAGAAGCGCAAGGACAAGAGTGGACGCGTGCGTGAAGACCGCGCCAAGCTTGTTATCAATCGCGAAGTAATTATTCTAGGGACT
TATGTGCACTCCGCCGAGACGTCGGTGCGTTGGAATACCTGGAAATGAACAACAAGTGTGTGTTTAGTGACTTGTTGCTGCTGCAGACATTCCATCGGAG
GATTTATTCAGTGCGCGACTCCAAGGAGAGTGTCGTGCTCGTCCACTACTTCGATGAGGTTAATAAGGAGTCCGCGAATCGTCAATTGTCCTCGGACTCG
AGCAAGAGCGACCTAAACTCGAGCAAAGGGATCAAGCGGGCGCTATCTGTCAAGACTAGCAGTGCTTCCTCAGGGTTTACGCCGTCGTTCCGACAGTTGA
GTCCTCTGAAATTTTTGTCGTCTGACGAGACGGTCGAATCCATCATGAAAAGTATGCAGGTGATCTTGATTGTATCTTTGAGATGCTGAGCGACTAATTT
TCGTGCTATCTTGTGGTGTTCAGACTGTTTCGAGGTGGATGTTGAGCCCCACTCGGCATCGGATCACAGTTCTTCGTTCAATATCTCTGATGCAGATCTG
CTGTTATTAAAGGACAGTGCAATGGATGGGATCATTACGGACTTTGGGGCTGACGAACTTTTTAACGATCTGTCTTCGACGACATCACCCGAAGAAGGCG
TCTCCGGCCAACAAACGTTTGAGCTGGCAGAAATATCGGATTTCTCACCAGACTGGGACTTTGGAGACGGAGGAGCCAAGGTTCTAATCTGCCTTGCAGC
TAAACTTCCTGAGAGACTGGCTCAAGATCCAATGAAGCTGTTTATTCAGTTTGGCGCGAAGAGAGTTCGCGCAGATAAAGTTTCGGACACGGTACTGCGC
TGCACTGGTGCGTTGATATCTTCTGGTTTGGACTAATGTATAGTAGGGAGTAGCACTAACAATTGGTAAATGTGCTGTTTACAGCTCCAAGCTCGCGAGA
ACTTGGCAGTGTTGACATTTGCGTGTGTAATTGGGGTGGATCGCTGCAACAGGAGAGTATTCAGCTCTCTCACAAGAGGCAGTTCACGTACCGAAGTCAC
TATTTGGTGTCACCTTCGCTTGTTGGCGAAATTGCGAAAGACAAACGTGTGTCCGAATCAGAATCTATCGACCCTTTCGAGCTGACTGCACCAAGTCCTG
TACATACTTTTGGCACCGGCAAGAGAGGTCGATCTCCAACTGTTCTATCCCAGGCTGTTGGAATGAAAAGATCCGAGGACAGATTCACCAACAGAAACCT
ATCGACATACGTCGAATCGGATTGTAAGTTTTTGATTCTATTGACTGTTTGCATTTCGTTCCTAGGTACTCACGTGTTGTGGCTTTTGTACATTGTAATT
AGTGGATGAGCGACAATGCAAGATTCGAGTCGTAGAGCGATTGTCTGAGTTTCACCAAGCTATACGCACCAAGACAACAGCACCTCCATCGAGAGATCTA
GCAGCTTTCGGCGCCGGAGACGTAAGCGGCGAGAAGAGCGTGAATCCAGAAAGAGAAGACTTGGCGCCTTTATCGACAGTATCACCGACTTCGACTACCG
GTAGCCAGGTGCAGCATTCTAGCCAGCAAATTGCTCAATCAAGTGGCTCTACCGAGCTTTCAGGTAACTCAACTTCTGCCAGCGAAACATCGACCGCATT
GGATGACTGCACAATCGAAGCTCTAAGCGACAACGATTTGGAGCAGCTCTCAGAGAAATTACTCGAGCGTGTTGTGCGGCAGCTTGTTACAGTTGCGCAC
ACGAATGAAGAGCTGCTGGAGGAACTCAACTCTCTGGATGAGACTGGTTTGAGTCTGTTGCACTACGTGAGTTTCTACAACTATTCGCAGTTGGTGCCGG
TATTGGTCGCTCATGGCGCCCACATTAACCAACAAAGCACCCAAGGACAGACGGCACTACACCTTGCAGCAGGATGCGGACACAACGAAGTCGTCGACGT
CCTGCTACAATTTGGTGCGGATTTACAAGTGCGCGACTTTGATGGACTCACTGCTGCCGACCGTGCTGAAAAGTCTGGGCATTTAGACGTTGCTGGAAAA
TTGCACCACCACATGGGGGACGACACCGGTGACTTGGGTGCAATCGATGAGATTTATGGGTTTGGAGGATCCCCTATGGAGATCGATGACGCCCCAACAC
CTTACACGGATGCTGGAGATATGGGCCTCTTGGCGGGCATTGACCACGTGCCTTGTGCGCACCAACCGCGCTCTCACTCGAACAGTTGTGAAAGTCCTTG
CGAAGCGAGCTTATCGTCAAAGGCGACATCTTACGTAAGTGATCTTTATATTTTATGCTGGCGGGTAATGGCGCTGACAGAAAGAATTTCTCTGAAATCA
TAGGTAGGAGAGAATCAAGAGCACAATCGCAAGCTTCTACTTGGAGCCTTTTCGACCATGAGCTTGCACGACAAGTGCGCTCTCTCGTTGAGTATTTCAA
GAGATTCGGCGGGTCACGTAGCCCGACGTCGCGAAAGCAGTGTTGGTGAAGATGTTCTAATCTCTCCTTGTAGCAGTAGCACGGGGACGTCGGTGGGCTT
TGGTTCGTCACCGGCAAGTATGGTTGGCGTGGACTCTAACCTTGTCGGCGGACGCTTAGTCTTGTCTGGAGCTGAGAACGACTCGGATGTTCAGAGTGTA
ATTGCTGAAGACGAGGAAGGTTTAAACAAGCTCCAAGCAGCGATGGAACTCATGGGCCCAGAGGAACGACAGTCTCTGGAAGACGAGGTCAAAGTGCTGC
AGCACGGGATCCGCGCGTGGCTGCTGAAGCGGAACTGCAAGAACATGCGGGAGACGACCAAACAGCTTCGTGAAGCCACGCAGAGTATCGAGGACCAACA
GAAACAACAGGAAGCGGATGAGAATCGCTCTCTGATGACCAGCGACGTCTCAGAACGTGAGCGCGCCGCCGTGACCGTCCAAGCAGCGACGCGCAGTATG
TTGGCTCGACGCAGCTTTTTACAGACTAAACACGTGGCGATCAAGTTTCAAGCGGCCACGCGCGGCGTGCTGTGCCGCAAAAACTTCGCACGCATGAAAG
CACACGCTCTGGCGTCACTGGTGATTCAACGCAATGTTCGCGAGTGGTGGAACAAACAACCAGCTGCAACTCGACCTGGTAGCGTTGACAGAGAAGTCGA
GGAAGAGGAAAGAGATACAGAAGAGAAAGCCTCAATCTCGCAAGACGCTTATGAACAGGCATTAAGGGATGAAGTACAACGCAGCTTGTAAAACTCAACA
GACAGGAAGTAAAGCATCACACACCCAAGTACTTGTAAGCTCCATCTCTCGTTTCTATTTGCCGCTTCCTCAGTACATCGACGGCTGTAACCTACCACAG
GAGCCTGTTGCTTAAAACCGTCTTTAGTCCATGGTCTCGTCTCCCTCGTCCGTGTATCGTCGGAAGCCCGGAATGGGAGGCGTCCAGGTGGCGAAGCCGA
GCTCCTCGGGTGCGGGTGCGTCGTCGGTCTCCATCGCCTCGGCCTGCAGCTCAGCAGGCAGCGCGTTAATGGCCTCCCACTTGAAGTCGATCTTGGTCTG
CACGTCGCGCATAAGGTGGTTGTGCTCGATGGAGGTCATGACGTTGTAGCGGCGGCCGATCTCCTGGTGACGCTGCTTCTCTTCCTCTGTCCACTCCTCC
CTGCAGCAAAATACGATAATAATTATTTAGTCAATAGTAACGGTATCAATAAAAGCTGTAAAGCAACGTACGCGTCGGGGTACTGGCCCTTGATGGCACG
CAGCATCTGCTCGAAGTTGGTGTCGCTTCCGCCCTTCTTGGACTTCTTCTTGTCCTTCTTGGAAGCAAAACCACGCACACTCGAGGAGGTAGCAGCCACG
TCAGCTAGTGCACAGGCGGTCGCGCGCTTGGCGGCCGCGGAAGTCACGCTACGCAGCAGCAGAGCCATGTCGAAAGTAGCCCGAGCTCTTCTTGCACCTG
TCGGAGTCTCTCGACCACAAGTGCCGGCTATCAAAGCCAAATAACACTAAGTACGAAACGGTGT