Description :
From Genome Similarity Track
Location :
contig_58:29349- 32282
Transcript NameFunction/comments
g10394.t1hypothetical protein
g10395.t1hypothetical protein

Sequence
2933 bases(100 bases per row)
ACGTACACAACGGTCGCTTTCCTACGGGCAGCCCCTTCCTCATTCCCTACCAGTTCAAGCATCAACAACGTTATTTGGTCGAAGAGGTTCAGGCGGGTTC
CGAGGGGCTTAATTAAGCCCGACTTTAATATCGGTGACGTTCAAGTCGTGGAGGAGTGTTCAGCTGGACGTTTACACCACGTGGCTCACAACACCGTCAT
GACGACAGTCTCTTCATTTAAAGATTCACATTTCGGATCGGTTGGGTAGAAAACAACGTACATTCCTCCGTATATGAAGTGAAGCAAACACCAGTAGGTA
CATGTATTGGCAATACTGAAGTATTACGTGGTCATTATCGGAAAATAGTATACTGCGGAGATCAAATGGCACGACAGTGCCTCAATTAACTACGGCAAGC
GGGAGCGAGCGCACGAAGGCGGACCCAGCGTCAAGCTTCCCAACCAGCCCTGCATTGCTGTCGTCATCCACACTCGCGAGCGAAGCATACCGCGGGAGCG
CCCAGCCAAGCTGATTATCAACGATGTCATATGGTGTAGGTTTGGGCCATGTTATACACTTCGACCTCGCGTCATCCATTTGCACAACGCTCTTGGTAAA
CAATTAGTTGTCCGTGGAAAGCAATACAAATTACTTCTCCAAGTGCTCGCAAGGATGATGATGCGTCTGAGCTTCGTTGGGCTGCTAGCTGTCGCACTCC
TGGCCAGTACCGATACGGCCTCAGCGCAGAAGCAAGCGGAGGTTTTTCACCAGGATCCCCAGACCCTGTCACGTTCACTTATCGAGAGCCATGACCAACC
CAGCACAAATGGATTTCTTCACTTTCACGAAGATGACGACGATGAAGACAGAGCGATCCTTCCTGGCTCCGTCATTGAAAAGACCAAAGCGTTCGCTTCT
CCAGCCACCACGGAGAAACTCCAGACCTGGCTAAGCAACGGGAAATCCGTCGACGACGTCTTCATTGGCTTGCAGCTTACCAAGGCTGGCGATACACTAC
TAGACAATCTGCAGTTCACGACGTGGCTCGTGTATGTGGACGATTTCACTGCCAATAATCCTGGCAAGACAACGTCAGCGATCGCTACACTCACCACTCA
CTACGGCGACGAAGCGGTCGCGAAGATTCTCGACGCTGCGAAAAAGGTAGCGGGGACGAAGGAAGTGGCCACCAAGTTGGAGACTGCGCAGATGCAGACT
TGGCTGGCGAGCGGGAAAACTGCCGACCGTGTTTTCAAACTCCTGAAACTGGATAAGGCGGGGGACGGCATCCTCAGCAACCCAGCCTTCGCGTCTTGGA
ACACGTAGCGGAAGATTTCCAATAAGGCCCATCCCGGTCAAAAGACAAGTATCTTCGCGAAATTGACGTGCAATACGGCGAGGTGGGTGTATCTCGGGTA
GTCGAAGCTGCATTGAAGGCCACAAGTTCCTCCGCCATCGCGAAAACAGTACAAGCCGAGCAATTCGAGCGCTGGATGGCCAATGGGAAAACTACTGATG
ATGTTTTCAAGCTGCTGGCACTTCACAAAGCAAGAAAGAGGCTTCTTGGGAACCCTCTTTTGAATACCTTTACCAAATACATGAACACTTACAACAAGGG
GAACCCCGACCAGGAAGTCACTTTGATAGGGACGATAACGACTTACTACGGGGATGTACGTCTAGCCAAGTTACTTGCAGCGGGAAGGAACGTCCCGGGC
ACGTCGAACATCGCCACAAACTTGGATGCTGCGCAGTACAAACTCTGGATGAGCGGGCGGAAAGACCCGGACGATATCTTTACGATGTTAGGCCTAGAGA
AGGCTGGGAATGGCCTTCTTTCCAACCCGCTATTCACCACGTTTACAAAGTTCACGGACGCCTATCACGCCAAGCATCTTGACATCAAGATGACTACGAA
TTGGATTGTGAGGACCCACTATACCGATTTTGACGTCACTAAAATGATCCTTGCAGCGGAGAAGGTGCCAGTGCCCAGAGCGCTGGAAAACGTATGGAGG
CTGTACTGTTCAAAGACTGGATGAAATCTCCGGATAACGCGTTCAAGGCACTCAAACTTGAACAAGTTAATCCCTCAACGCTGTTCGAACGCCTGATGTT
CGCGTATTGGATGAAGTTCATGGATGATTTCCACAAGGCTTTCCCCGGTAACAATATCCCTCGGACCGTTCTAACGACGGCCTACAAGGACGAAGATCTG
GTAAAGGTGGTCGAAATGGCGCAAACGAACCCGAACTCGAAGGATCTTGCGAACAAGTTGGAGATAGAGATGTTCAAGCAGTTCATATTCGCAGAAAAAC
AACCGATCGATGTTGCCAAACTTCTACACGTTAGTGAAAAGATCGATGCGAATTGGAAACTTTGGAAGAAGTACATGCAGGACTATCACAAGCACCACCC
GGGAAAGGTCACGATCAAGTCGTCCACGTAGTTCCGAGAGTCCGTAGATTCGCGTTTCTTGTAAAGCACTTCCGTCGTGCTTTCTCTTCTCATGAACGTA
ACATAGCATATAATCCTTGATAACCTGGAACTTGACGTAAGGTGTCAGGTGTCAGGTGTCAGGTATCAGCCTTAAACTACACGTGGATGTACCCAGCAAC
GTTGGAGGCCATAACCATAACCATACCTTGCTACTTATGTGCTATCATAGCTACCCTTTTCGACGGTGTGTGAGAGACCCTACTATGCAGATTCAAGTGA
ACAATGACTTTAGTGCGCTGTGTAATTGCCAGGAGGTGAGGCAAGTCCTATTGTAGTTTTGCTGCACGCCTGGTGGAACAGGATTGATTGGTGTTCTTGT
TTGTTCCTCTGTCCGTTGCATCTAGCTGGGAGCCAAGAGGTTTTATGGTCAACCCGTTACCAAGGAATGTCGACCGTCCCGAACGGGTATTCGCCTGCGT
TGGGCGTGGAGTTCGAGCAGAGCGAGCTGCGGA