Description :
From Genome Similarity Track
Location :
contig_58:29343- 32276
Transcript NameFunction/comments
g10854.t1POM64006.1 Secreted RxLR effector peptide protein [Phytophthora palmivora var. palmivora

Sequence
2933 bases(100 bases per row)
TCGTCGTCTGGCACCCTCAGCATCTCGATCATCACGACGTACACAACGGTCGCTTTCCTACGGGCAGCCCCTTCCTCATTCCCTACCAGTTCAAGCATCA
ACAACGTAATTTGGTCGAAGAGGTTCAGGCGGTTTCCGAGGGGCTTAATTAAGCCCGACTTTAATATCGGTGACGTTCAAGTCGTGGAGGAGTGTTCAGC
TGGACGTTTACACCACGTGGCTCACAACACCGTCATGACGACAGTCTCTTCATTTAAAGATTCACATTTCGGATCGGTTGGGTAGAAAACAACGTACATT
CCTCCGTATATGAAGTGAAGCAAACACCAGTAGGTACATGTATTGGCAATACTGAAGTATTACGTGGTCATTATCGGAAAATAGTATACTGCGGAGATCA
AATGGCACGACAGTGCCTCAATTAACTACGGCAAGCGGGAGCGAGCGCACGAAGGCGGACCCAGCGTCAAGCTTCACAACCAGCCCTGCATTGCTGTCGT
CATCCACACTCGCGAGCGGAGCATACCGCGGGAGCGCCCAGCCAAGCTGATTATCAACGATGTCATATGGTGTAGGTTTGGGCCATGTTATACACTTCGA
CCTCGCGTCATCCATTTGCACAACGCTCTTGGTAAACAATTAGTTGTCCGTGGAAAGCAATACAAATTACTTCTCCAAGTACTCGCAAGGATGATGATGC
GTCTGAGCTTCGTTGGGCTGCTAGCTGTCGCACTCCTGGCCAGTACCGATACGGCCTCAGCGCAGAAGCAAGCGGAGGTTTTTCACCAGGATCCCCAGAC
CCTGTCACGTTCACTTATCGAGAGCCACGACCAACCCAGCACAAATGGATTTCACTTCACTTTCACGAAGACGACGACGATGAAGACAGAGCGATCCTTC
CTGGCTCCGTCATTGAAAAGACCAAAGCGTTCGCTTCTCCAGCCACCACGGAGAAACTCCAGACCTGGCTAAGCAACGGGAAATCCATCGACGACGTCTT
CATTGGCTTGCAGCTTACCAAGGCTGGCGATACACTACTAGACAATCTGCAGTTCACGACGTGGCTCGTGTATGTGGACGATTTCACTGCCAATAATCCT
GGCAAGACAACGTCAGCGATCGCTACACTCACCACTCACTACGGCGACGAAGCGGTCGCGAAGATTCTCGACGCTGCGAAAAAGGTAGCGGGGACGAAGG
AAGTGGCCACCAAGTTGGAGACTGCGCAGATGCAGACTTGGCTGGCGAGCGGGAAAACTGCCGACCGTGTTTTCAAACACCTGAAACTGGATAAGGCGGG
GGACGGCATCCTCAGCAACCCAGCCTTCGCGTCTTGGAACACGTAGCTGAAGATTTCCAATAAGGCCCATCCCGGTCAAAAGACAAGTACCTTCGCGAAA
TTGACGTGCAATACGGCGAGGTGGGTGTATCTCGGGTAGTCGAAGCTGCATTGAAGGCCACGAGTTCCTCCGACATCGCGAAAACAGTACAAGCCGAGCA
ATTCGAGCGCTGGATGGCCAATGGGAAAACTACTGATAATGTTTTCAAGCTGCTGGCACTTCACAAAGCAAGAAAGAGGCTTCTTGGGAACCCTCTTTTG
AATACCTTTACCAAATACATGAACACTTACAACAAGGGGAACCCCGACCAGGAAGTCACTTTGATAGGGACGATAACGACTTACTACGGGGATGTACGTC
TAGCCAAGTTACTTGCAGCGGGAAGGAACGTCCCGGGCACGTCGAACATCGCCACAAACTTGGATGCTGCGCAGTACAAACTCTGGATGAGCGGGCGGAA
AGACCCGGACGATATCTTTACGATGTTAGGCCTAGAGAAGGCTGGGAATGGCCTTCTTTCCAACCCGCTATTCACCACGTTTACAAAGTTCACGGACGCC
TATCACGCCAAGCATCTTGACATCAAGATGACTACGAATTGGATTGTGAGGACCCACTATACCGATTTTGACGTCACTAAAATGATCCTTGCAGCGGAGA
AGGTGCCAGTGCCCAGAGCGCTGGAAAACGTATGGAGGCTGTACTGTTCAAAGACTGGATGAAATCTCCGGATAACGCGTTCAAGGCACTCAAACTTGAA
CAAGTTAATCCCTCAACGCTGTTCGAACGCCCGATGTTCGCGTATTGGATGAAGTTCATGGATGATTTCCACAAGGCTTTCCCCGGTAACAATATCCCTC
GGACCGTTCTAACGACGGCCTACAAGGACGAAGATCTGGTAAAGGTGGTCGAAATGGCGCAAACGAACCCGAACTCGAAGGATCTTGCGAACAAGTTGGA
GATAGAGATGTTCAAGCAGTTCATATTCGCAGAAAAACAACCGATCGATGTTGCCAAACTTCTACACGTTAGTGAAAAGACCGATGCGAATTGGAAACTT
TGGAAGAAGTACATGCAGGACTATCACAAGCACCACCCGGGAAAGGTCACGATCAAGTCGTCCACGTAGTTCCGAGAGACCGTAGATTCGCGTTTCTTGT
AAAGCACTTCCGTCGTGCTTTCTCTTCTCATGAACGTAACATAGCATATAATCCTTGATAACCTGGAACTTGACGTAAGGTGTCAGGTGTCAGGTGTCAG
GTATCAGCCTTAAACTACACGTGGATGTACCCAGCAACGTTGGAGGCCATAACCATAACCATACCTTGCTACTTATGTGCTATCATAGCTACCCTTTTCG
ACGGTGTGTGAGAGACCCTACTATGCAGATTCAAGTGAACAATGACTTTAGTGCGCTGTGTAATTGCCAGGAGGTGAGGCAAGTCCTATTGTAGTTTTGC
TGCACGCCTGGTGGAACAGGATTTATTGGTGTTCTTGTTTGTTCCTCTGTCCGTTGCATCTAGCTGGGAGCCAAGAGGTTTTATGGTCAACCCGTTACCA
AGGAATGTCGACCGTCCCGAACGGGTATTCGCC