Description :
From Genome Similarity Track
Location :
Scaffold_370:29341- 31703
Transcript NameFunction/comments
g12101.t1hypothetical protein

Sequence
2362 bases(100 bases per row)
GTACGGCTTCAGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCGTGCTGGACGGTATGTCCAGTGTGTACGCGTTGCCATGCTTCGCCAACACGGTTAAT
GGCCCAATGAAGCGCGGAGCAAGCAAGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGCGTAGCTAACAGAACTAATGAACCAATTTTAA
ATTCATTTGTGTTTCCCCTGCCGGTGTTGCCGGCGTTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCATCTTGGACAAACCGAATTACGGCTTGTCG
ACGCTGGAAAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCGTGATGTTCGTTGTCGTTT
AAAGTGTCTACGCCCGTCGTAGACACTGTCTTTTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATACATTGCTCGTATCAGCGT
GCTTATCGGGTTGTTTTGAATTAACCGGATATCCTCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCGCATGGCATT
CACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCG
TAGTTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGTCGACATGGACAACTGCGTCCCAAGAA
GTGTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATACTATGGTGTCTAAACACCAGGTCAACAAA
CAGACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACAATACCATGTTGTCTT
GCGGAAGACCAAAAACAAAGTCCATTGAAATGGACTGCCAGCACTCCGACGGAGTCGGTAGTGATTGAAGCGAAGCCTGCGCGTTGGGCGCAGGCTTCAC
ACGCTGGCATACCTCGCAAGCACGAACGTACTTGCGTACCCATTTGTACTGGTGACTAAAATAGAAGTCACGCGTGAGAAGCAAGTATGTCTTCTCACGG
CCAGGATGTCCCGATGTCGGGGCATCGTGGTACTCGTACGTGATCTTGAGCTTCAACTCATGATCATCCGGCACGACAATGCGATCGGCGTTGTCGTCGA
CTGCGCTGTAAAGCAGCAGACCATTGTGTACACGATAACGGTGTACACGAGCACGGAGGTGTTTGGCCAGCTTCTGACAAGACTTGTCAGAAGGTGTGGA
GAAGTACTCCACCAATTGCTTCGCATCCGCATCATGTGCGTATGCGGCCTTCACTTCGTCCAGCAAGGACGACGAGGGTGTAGTCGTCCTGACGACGCCA
ACTGCGTTGGTGTCGGCCTCTTGCACCGCATAATCGGGTCGACGCGAAAGCGCGTCGGCCACGACATTCAACCTTCCAGGTTTGTACTCAACCTGGAAGT
TGTATTCCGCAAAGAATGACAGCCACCGTGCCATTCTTTGGGATATGTGCGGCGACTTGATCGCCGTACGCAACGATGCGTGGTCGGTGTAGACCACGAG
TGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCGAGTGCATACTTCATGGCAAGGAGTTCCTTGTCATGTACCGGGTAATTGCGCTCAGCTGTCTTC
AGCTGACGCGATTGGTAGTAGAGCACACGATTACGAAGGTCGTGGTCGAGTTACATCAATGCGCATCCGATCGCGAAATCGGACGCGTCACATACCACGT
GGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCTGCTTGACTGCTTCAAAGGCCTGCTGACAATCAGCAGTCCATTCCCA
TGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAATTGCCGC
AGTTCCTTTACATTTGAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGG
TATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGCGTAGAGCTTGTACTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTCC
ACATCCGATTTCCCATTCACAACCCGGCTGTGAATGAACACGTCGTCGAAATAGCTCGGTGC