Description :
From Genome Similarity Track
Location :
scaffold_268:29335- 31848
Transcript NameFunction/comments
Pl_106805AlNc14C148G7453
Pl_106806AlNc14C988G12696

Sequence
2513 bases(100 bases per row)
GAGTGAAATTCATTGCCAAATTCAACCTGCTCAAGGGATTCTGGCAGATCATTCTTGCGGAGGAATGTCAAGCGATTATCAGCTTTATGACGCATGATGG
TGTCAACACACCTATACGAGTACCGCAAGGTGTAACCGCTTCTGCACTTTACTTTCCAAATCAAATGCAGACGGTGTACAAGCCGCTGTTGTACAAAGCG
GCTCTAGTGTGATCGTTGACATAATTGTTTACTGAGAAGAATATCTTGAGAATCGTATTCTTTTTTTTAGCTTACGGCAAGATATAGGCTTAAGCTCAAC
ACCAAGAGGAGTGTTTTGATGTCGTTTGAAGTATCTTGGTGTGGCCAAATTATTGATGGAGAAGGGATTAGACAAGATCCACAACGTCTCTCATGATTAG
TCTCATTGCTCCTTCCAATAACAACAGGAGATTTGCAACAATTCCTATGTGCATGCAACTGGATCTGAAATAGGATTGTAGATTTTGCGAGAATATTTGA
GACATTCCAATCTAAGTTAAATGGAGTTTTGGTGAATCGAAGCAGAACCAAGATCTTAAGTTGGACTGAGGAAGAGAGAATGAACTACTCGCTTGTGCTT
CAATTCATTGCGAATACAGCAAAATCGTACTTTCCTGAAGATCAAACAATTAACTGCCCCATGAAAGATGCATTGGATCATGGATACGCTATTATCCTGA
CGCAAGTCTGTAAATGACAGGAGCATGTTGCAGTAGAACATCAGAAACACGAACTGTTAATTTACTAGGGTGGAATTTTTAGGAGGAAATATACACTGGT
CGGTTGTGAAAATAGAAGCATATCCTGGGGTGAGAGCTTGTGCTTCGCTTGACTGTATATTGGAGAGATAGCTAGGATTTAAAGCATTTTGTGATCACTC
AAACTTGATTAAAATATTTTCACCGTCAGAAAACATTAAGAAGCACACCAGAGGAAGCTTCTCCGGTGGGCTTTGATGATTTCATGTCTTCGTTATACTC
TTGAACATATGGGCAGACATTATTTCAAGATGGAAACCAGCTCTGAAAGAGAAACGACAGGCAATGGTGAGTATCAAGGTAGCACGTGTATATAGTCAAG
CTCATTTTTCGAGGATTCGAACTTTACAAGATGAAAACTTTGTATGGCCTACCATTCGGGATGTCAAAGGAGCTCAAGGCAATGTAAGCTCACCAGGTAT
ATGAGCCACCGGGAACTAGCAATGTATTTGGTTTATCGATGGGAAACTTTGGCTTCCATCTAGTAGAAACTACATCTAGTTGTGATAGTTGTGCATTATG
GTGTTCGGTCTCATCGTGGGGCAGACACGATGCTGCAAATTCTAAAGGATGAATTTGTATTTGAAGATATAGTAAGAAATTGGAGAATTTTGTTGCAACT
TGTCTGTTGTGCAAGTGTGTCAAAGGAGGTTTGCTAATACAGAGACCACGGAACATAATACACAAGACCACTGGACGAAACGAGCCGTTAAACATGGACT
TCTTACATATAGGAGAGAGCTACGCTGATATGCAATATGTGTTGGTGTTTAAGGATAATATCACACTTTTTGCGAACTGGTTGCATGTGAATGCGCCAAT
GTCATAGTGGCGGCAAATGCAGTCTTGGACTGGTACAAAAGATTTGGCCTTCCTGAGATGGGGCAATCTGACAATGGGTTACATTTTCGAAACACACTGA
TGGATGATCTGAAAGCACGACTAGGAACACTACGCCAACTTGTGTCAGTTTATACTCCACGGATCAATGGTACGGCCGAGCGAGTAAACCGAGATTTACT
ACAGGTTGTTAGGGCATTGCTTCTAGAATTTGAGCTGGACACAAGTAAATGGGTGCATCTCCTTCCAGTAGTTTAATCAAATCTGAGTCATACGCCGGTG
CGATCACTAAGAAGAAAATCACTTGTAGAAGTCTCCACAGGATTGAGTCGCGAACTAATCATGAATGTCGTGGTGAAGACATGGAAAAGGTCAGTACCGC
CTGAGGTGATTCAGCGCGAAGAACTTAGTTGTGAGGAGAAATTGGAGGATCTTCGTGACACTTTAGCCGAATTACATGCTGACATTGCAGATGAAAAGGA
GCGACGGAGATTGAGGCAGCAAGCAGTGAAGCCTGGTAAGGCATGTACTTTTTCGGTGGGTGACTATGTACTCTGGTCGAGGGCAGACCCGAGAATGATA
GGCCGTAAGCTAATGGTAAGGTGAGTTGGGTAGTAGAAGAGCTTCCTACAAGCTTCCAAATTGAGCGCATACTGACTGGCAAGAAGTTCGATGTACATGC
TATCCGGCTACACATTATGCAAACAATATGCTCGAGATTACAGAAGAGTTGAAGCAACACATTGGTCTACAGGGACTTAATATTGGAAATCACATATGCA
AGATACAATAGTCACGCACGGAAATAGCAGATCCTGGTTGGTTGGCAAGGGTTTGAGAAGCTGGAGAACCCTTGGGAATCATTAACTCCCATTGGTGGTG
CAGTTCCAGACAA