Description :
From Genome Similarity Track
Location :
Scaffold_98:293346- 295178
Transcript NameFunction/comments
Physo_141452hypothetical protein

Sequence
1832 bases(100 bases per row)
AGCAACGGTGCGGAGCCTTGCCCCTGACATCCAAGGCACGGACGATGTCAACCTCAGTGTTGTAATCCCAAGGCTTCTTCGGGTCGTAGTGGTTCTTGCG
GTTGTTCGACGGGTGCTTTTTGGGCGCCGGAGGAAGCGGCATCGGATGACACGTCGAAGTCTCGTCATCGTGACGCAAGCGCGAGCGGTCAACCTGAGGC
AGGCCTTCATTGTCGTCACTATCATCGAAAAGCCCGGATTCATCTTCAGGCGAGGCCTCAAAGGTCGCCCCAAGCGCAGGCTCAGCAGCTATCGCCTCCT
CGACAGACAACCCTTCCACATCGAGCATGAAGATCAACTCCTGGAGGCGCGTAGGTGGAGAAAAACCACCAGCCGAAGCAACAACCTCACGCGGCGCTGG
CGACGCAGGCGGCGGCACCGGGGACGCCGAGTCCGAATCTGGAGAGCCAAGACCGGGAGAGCGACTGGTGAGCTCTAATTCTTCCCACACACGCACCATC
TCTTCGTCAAGACCGGAGTCAGCATCGCTGTCTTCACCAGCAGCGGCCACAACATCGACAATCTGCGCGAGCGCGGCGGCGCATTCAGAGTCTGCCGGCG
CGGCCGGCGTGGCGGCGCCAGGCGGAAGCATGGACGGACCATCGAGATTTGCGGTCGCCAGAGGCGACGCAGACGACGGAGCCTCAACATCATGATCAGC
CGTCGCTGGAGGCGAGGCAGAACGCGCGGAAGCAGGAGACTGCATTCCGGCAGCAGTAGAAACCGCTAGCGACACAACCATCAGCCCAAGGAACCAATCC
AAGCCTCCAACAACCAGGCCGAGGCGAAGGAGAAGCGAGGTCGGACTAATTCCTCAGGCGACAGCCGGAAGCGTCGCGGTTCTCTGTCTTTTTCGGGAAT
GACAAGTCGGAAGGGCGCGCAGCCAGAGAAGGGGTGAGTGTATCTGATTGGTAGAAAGGTAAGCCAATAGGAGGTCAGTGTAGGTACGACTCACCGTAGG
TATAGTGAAACCAAGTTAAAATAGATATGCAGATGGAGGGCGGCTGTGGAGGCTTCGCGAAGCTTCCATCCGCCTGAACTGCGGGGGCGGCACTCTTAGT
TCCGCACGCCCTCCCCCAAGACAGCAGTTCTTCCTGTTAAACGTGATGTAACAAGCAAACAACGATCTATCTTGATGCAATTAATATTTGTTATGGCGGC
GAGGGTGGCCCTCGTGCTTTTCTCCTACCTACAGACGACGACACACTCTCCCCTGTCACTTCTCGGCTAGACAGTGGAGGGGCTGGAATCGGAATTGGTT
CTGGGGTTACAGACGCGGATGCGGATGCTGAGCTTACAGACGTAGGAGTAGTGGGGACGGTTGTGACTTCAGGACCAACGGGTAGCACAGAGGCTTTCGA
GCGTTGCCCTAACAGTCTTGACGAGGGCGGAGACACGCTTGGCTCCGGTTGAGTAGCGAGTTTCTTGGTGCATATGAGCGGCACATTGTGCTCATTGAAG
AACTTCGCCGTCTCACTTTGGCTGGGGTTCATATTCCAGTTTGCCTTGATGTTGCGAGCCTTTTGACACCGGTAGATAAAGAGCAACATGCTTGCCGCCG
CTCGCATCCGTCTCAACGGACTCAGCTTGTGCATATCGCGGTGCGCGAGCTTAACCACGCCGCTGATCGTGATAATCGCTCCTACCGTGAACATTGCCAG
AGCTAGGGGAGACATTTGCGCGAACTCTTTAAAGTACACGCCACCGCCGAAGATGGAGACGGAGATGAAGAAGCACTGGAACACGGGCACGACGAAGACG
GCGTCGAACTTCTGCAGCCCGTGCGCGAGCCA