Description :
From Genome Similarity Track
Location :
Scaffold_357:2933376- 2936886
Sequence
3510 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNGTGGGCATAGCTGCACAGAAAATTCGAGTTGAGACGGGTGCACCTGTGCACCAGAAGGCAAATTCGAAAGTAATAGCATTGTTC
TAGGGTATTCAGAGTTGCTTCGACGGTTGCCTCTTCTCCAAATTGAAAGTTCAAACGTATCAAGGTACTCTCGTAGATTTAATCACAGCACCTCACGTTG
AATGTCGTGAAGTAGCGATTAATTCTGGCTCAGATTAAATCCATTTTTCATCGCATCTATCATCATGTGAGCTCAAAATCATTGGCATTGTGTATTTTAA
GGATTTCTCCACCACATTTTGAAGAGAAATGAATGCTATTGACAATGTGCCCGCAATTCATAAATCAACGTTCCGCAGCATCAAGTGGTCCTCGATTGTT
CGAGTGCAATCAGATACTGCGCCTTCGAATTGAGTTAAAGAATCTTAAGCTTAAGTACGCATGAGGTAGAGCTCTCAGCATCTGCCACGACGCCTGGGGC
ACTTGCCGACTTGAGACTTCATTTACTTCATTCCAGTGTTTCGTTTTTCGTCTACAATTACCTAAAATAGTACTACTTTGGACAACAATACATTTAGATA
TATGTAGAAAAATTAAACGGATTTGCGAAATGGCCTGAATACAATTGTGGCCCTCTCGGGGAGAACGCTTTTCGTAGACCCAAACGCGCGACACAATATC
CGAGTGGCAGTTAAAAAATAGGCAAGCCGCAAGATGGCACCACAAGGCAGAGCGCCAGAGGACGAGACGGAAATCAGGCTCTAACAGATTGCGCGGCGTT
CCTCGCGGCGAGGAAAGCTTTGCCACCATTTCGGCCATGTGGATTCCATGAGTGTTCGGCAGTGCTGATCGCGAGTTGCTTTGGCATAGCTTAGAGTAGC
TTGATGGATATGTGCTGTTCCTGCGATATGATGTTTGAGGGAATTGTGAGGGGTCAAAGTTTGGCCGCAGTGTCATGACACTTTTCGCGTTCACTGTCTC
ATTAACTAGACGCCCATAAACTAACCAATCAAAGCATCGATCTTGGGCTTTCTAGTGCACCAATCGCCACATAAGTTGGGCAACATGTATAAGAACTCCA
CTTATCGAGATTCGTATACAGTAGTGGGAAAGACGGAATACAAGGCCCACCGAAGGATTTTGTGATATTACTATTCTCGATATACTACAACATCCTTGGC
GGAATTTTTATGTTCGCCCCGCGGGATTTTTATGCGAGGTGCAATTTAATTTCATTTTGAAGTGATTAAAATTAGTCATAGTCATTGTGAAAGGCTAAAA
TACCCATCGAACTTCGAAGCTCTCTGGCCAACCAGAATCCAGAGTTTCACGCGATATCGAAGACTAGGGGGAGTGGTGCATTCTGTCTTTGCCAGTACCC
TGCTCATGTTTTGGGCCAGAGTCGAAGTGTATTTCAATAGTAAAAGTAGGATTGTTCATTAAATGACCCTCTGCACCTCAATTATTGGCAGTAAAATAGA
TTTATCGGTT