Description :
From Genome Similarity Track
Location :
contig_49:29333- 37990
Sequence
8657 bases(100 bases per row)
TCTCTTATGCGTCAAAACCATTCTCAGCAACAGCGTACAAAGCTGGGCAAGGGCCAACTTTCTGAAAGACTTTGACGCTGCCCCTGCACCCGTGGAAAGC
GACGGGTTTTGTGAGCGAGAACTATCTGTACTGGGACCTTTATTGAACACTCAGAGCGATCTTTGCGGCAGATTCAAGCAGGTGGACACAAACGTGGGTT
TTCTGATGCAAGTGGACTTTGTGGAGTCTAGCCCAGTTAATACAAGCTGGTCGTGGTATTTAGGTCTGCCTTCGGCTCGGTAACGGGCTGTCGTGGTCCT
GGATGGTGTGGTGATGCAAGATTTGATGGGCAAGACTGGGTATTGGAAAGGTGTCCTCACGAAAACCACCCAGTTGACATGAAAATCACACCCGTTTTCA
TGTGTTGAAGGTTTACGGATTATCTGCAAAGTTGAAGCATCGAGTCTATATTTCAGTCGCGAAGGATCCAACCCGGTACTCGTTTCCACCGCTGCTCTCA
TTACGGAACTCACAAAATGGACTCCCTTTGCTGCTCCTGATTTACGATATCAGCTACGCTTACGGCTGAACAAGCTAACAAAGCTAGCAATGTTGGCAGA
GGGGTATCAGTACTACAGTTCCAAAGTGCACCTGTTGACGGACGCTTCGCATTGCACTTAGCAGCGCTATCGACGACAGATACCCCGAGTGCTAAGCTAA
TACCTCGTCTTAGTGTCCTTCTCGTTTCTTCAACTTTCGATGTGGGCTAGTGCAAGGGCATCTCAAGTTTCTTTTGCTACAGCGGTTAGCACACTATGGA
GTGCGATACCTGGCTTAAGTATGACCCTGACGCCTGCAACAAGTGGGGTTCTCATGTGTTCTTTTACGGGAAGATTTTTCGTGGACAAAAGTACTGTGAA
AACGTTTCGTCTCGACCTTGGGTTCGGCACAAGCACTACATCAGTCACCTCACAGTTTCGCTTGGATGAATCATTTATTGACCCTTCTGGTGTGCCTCTT
GAATTTTCTTACTTTACTAGCGTTCCAACAGCCAGCGCACTGAGTATCTTGCTCAGTTATCAATACCAAGGAACGAAGACTGGAAAGATTATTGGTAGCA
GAACGACAGCCACATTTGTTCCAGGGGGTTCATTAGCTACTGAAACCTTGAGCGACAGCACGGCTGCCTTGAATAGCACGATCTTCTCCAAAATGGTAGT
ACTCTCTTCCTCAAGCACATTGATAATTCGTGTTGGTGGTACCATCTGCCGCAATGCAGCCACCGAAGTATTTCGTGCGCGCATATCGAAAAACGGAAAC
CCGATCTTTGATGGAGATTTCTCTTCAGTGGCGGGGACAGTGTTGTCAGGAATGTGTGAGCCTTTGACAATGCACTCTATTATCGATTGTGTTGCAGGCT
CCCACACAGTAACAGTTGACGTTAAAACATCGACGAGTTCTGGGTACCAGTTAAAAGGGGTGCAACTACAAATTGTCACGGTCGAGAGAGGTGCCTTGCT
GTCGCAAGAAATGTGTCAGTCACGCTGTTCACGGCATGGTCTATGCCGAGTAGGCGTATACAACATTGCTACGAAGGCATGCAACCTTTATATGACTCGC
AATTCGTCCTCGTTAGTGACAGATCCAACTCGCGTGGCGTTTGTAAGAACCCAGGAAGTGGTTATTTCGGGGAATGCGTGGACGATTCTTCACAACACAA
AGTGGGCACTTGGACAGAATGTATCTCTTGCAACCCCATGCAAAGGCGACGCGTGCGGAACTGGTATTTGTTCTCAAACGTACACATTGAAAGAGCGCTG
CCGATGCATTTGCCAATCAAGCAGTGACTGTGTAGGCTTCGCAAATACGGATGGAACATGTTATGCTATCACAGCATCAGACTTTCGCCAAAGTGTCCAA
TTGGGCACATATAATACCTCAGGTGCCGCTACTATTCATTTGAATATGCCTCAGACTTGCCACGCTATCAAAGTCGATGCCCCAGATGCGGCAACTGGAC
GATATGTCATAGCGACGTCAGCAGGAATATATGATGCGTTTTGCAATATGACCGCTGATAGCGGTGAGGGATACACGATTGTGCCGTGTGATTTGGGCAT
CAGTGACATCAATTGTCTGAGCAGTGCTAGCCCAAAAGACAGTGATAGTTGTAAGATCATGGGTCTTCAACAAGTGGTACCGCGGTCTTCGGGGCATTTT
ATATCAATGCACCGAAAATATGGAGCACTCTTTTTCTCGACAGTTCCCGGAGTAACCAATGCCTACGTTGGCGATAGTATTGACCTACCAAGTGATGACG
AAACTGTGCTCGATTGGACAGCAACCGATGGAGGAAAATGGTGGTTACGTGATAACGGTAGCATTTGTGATACTGTATCGCCTGCGAATGCACCAGACGA
ACGAAGGTGGATAGGCATGCATTCTGCTTTCAATGGCCAAAGTGTGTCAGACGGCTTATCTTTTAGTTTTGATCCTCGTGGACTGGCAACGACTAGATAC
TTGTGTTCTACCAACGACGTTAGTCCATCAACCTCTTGGAGTGTCACTCTCCAAGACTCTTTTATTGGAAGCGGTGATGACAATCTCTGGGTAACTTCTT
GGAGCGGTGCAGACAAGTGGTACCAGCTTTGTCAAGGAATCGTAATTCTTGGAGGTAGATCATTCTCACGGGTCGGATCCTTTGTAAGGAAAACATTGAG
CCCCATCAACAAGAGCGACAAACCATTTAACGCGCGCGTCAAATTCACATACTATTTTGTGTTTGAACCACTTTACTGGGTAGCACTTCTTCTCAAGAGC
TCTGAACCGAGGACTATTCGGGTTTACCTTGGTACCCAACTTGTTCGACAGCTGCAAGTTGATACCTCAGTGACCTATGCTTGCTACGGACAGAGTTCGA
CCTCAGCGCAACAGGCATACTTCTACCGTGGAAGGGAGCGATTTGCTGTGAGAGGATTTAGCGGAGCAGCAAACGAACTACGTTTTGAAACGGATTTTGG
TTCGTTGAACATCAGTGCCTTTGGGATTGACGAAGTTTCAATTGAGGTGGAATCATCGTTTAAGACACCTCTAGGACTATCGTTAGCAAATCCCGCGGTT
TCATGCATGCACCTGAAGAGCGAGCGTGCTGCCAACGGTGATGTGAATCCAGATGGCCAGTACTATATTCAACTCGACCCAAATGTTGATCCAGTCCTTC
TTCCTTGCTCTGACGGATGGATAGTTGCACAACGCCGTGTAAACGGCAAGACAACTTTCAATCGCAATTGGAATGAGTATCGTGACGGGTTTGGTCTTGG
TTCTGCCAATGAGTGGTGGATTGGAAATGATATTCTGGCTACTATCACAGCACGAGTCACCGAGGCAATCATCGTCGTATCCAAAGATTATAAGGACACT
TCCGCGTTTTATAGTGATTTTCGAGTGGCAAGCGAAAAGGAAAAATACTTATTGACTGTGCGAGGGTACAATTCGACGGCGAGTTATGCAACGGATGCTC
TTACCCCGCTTAGTAATATGTATTTCAGCACACCAGACCAGGATAATGATCTGTCCGCGAGTCAAAATTGTGCGAGGCGAAGCCGGAGCGGATTCTGGTA
TGCAGACTGTCTTAGTGCAACTAGATCCGATTTAAACGCGCCATTTGACATGCTACCCATTTGCACATCCTACGCTGCATGGGCGCAAAGCTGGTGTCAG
AAAACGGGGAGTATAGTATGGGATAACGTGGATGGTTATGACTCCTCAAAATTACTTTTACGGCCGGACAGATGCCCACCAGGCTACACGAGTTCACAGA
GTGGCGACTGTTCACAGTGTCCGGCGGGTACCTATTCAGAATCACACTCGAACGGATGTACGATGTGCCCTGCCGGGACGTATGGGCCGTCGGTTGGGTT
GTCAGGTGTTGCAGCGTGCATATCGTGCCCATCAGGTTTCAAATGCTTAAGCGGTTCAACAACACCAGTTAAATGTTCTGTTGGCACCTTTGCTGACGCT
GGATCAAGCGAATGTTTGAATGTCCCAGAGGGTTATGCGGGTCCATTTGATCAGATGGCTCGAAGAGATTTCGTTCCTTGCACGAATGGAACTTTTTCGA
AGCCAGGTCAACAAAATTGTAGCGCAATCCCCGCTGGTTTCTACTGCCCCTCCAGCGGGGCCCTTGTGCCTACACTGCGTTAGCGCCTTGCCCCTCTAGA
AATGTGTACTGCCCAGAAGGAAACACTGGCCCTATCATTGTGCCACCTGGTTATTACTCTGTCGGATCGATGGTGAATGAGCAACAATCTGGAATACTGT
CCTGTCCAAGAGGGTATTATTGCCGACGAGGCACAGCATATCAGTGTCCACCTACTCGATTCGGCGATCAAGTAGGTCTCATCAACTCACTTTGCTCTGG
TCGATGCGCGCAAGGTTGTGTTTGTAAGGCTGGAAGCGTAAGCCGATGCCCAGATTCTCCCAGTGGCGCTGACCAAGTAGTTTTGACTTCGTCATCAATC
TCATATCTTCTCGCACCTTTATCGAAACAACCAGGTTCAACGGACGACGCCCTTACGCAAGGTGTTTTTGCTGCTACAAGTAGTTCTGCGGCTGTTTCTA
TAGACGTTTTCGAGTTCAAAGATGTAAACCTGACTGCGTTTAAGACAGGGTGGTCTTCTGGGTTTGCACACAACATATCGCTTTCTTATTTCGAACATTC
ACAGACGGATATCACCTACGAGTTCAACTGCCCGTTGCTGGATTTGATTGGGGTGCTGTTGTATTGCTAGATGGGATTATCGCGGTTCCTCGCTCACGAA
ATGGTACATTCACATTTGCGTTTGTGTCATCGTCCGGGGCCCAACACTATTTGTCCATTATCGCAGCTGAATCACAGTTTGCAGTCAAAAGAACAATTTT
ATTCCGAAAATCTACCGATGCAAGCTTTCGTAACTTGCGTTGCGATCGTTTCGACGGCCAGTCTATCTCATTAGATATCGATATCGCGGTATGCGGAATT
GCCGCCCCAACTTGCACGGGTAGTGTCTATGTCAACGGAGAAACGGTGAAAACTATAGCAGATACAGCAAATATCTTACATATTTTAGTGTACTCGGCAC
TTGGCACGAAGATGTTTGACACTACTGTTGACGCTACGATGTCTAATAATTATATGCCCACGTTATCTGCGATGGGTGCTGGGGATATTGCTGTTCTCAT
TGGTACAAGTATCGTGAAAATTCCGTCGAGTTTGAGTACCTGGATAACCGGGTACGGCATATCTCAGATTAGTACTAACTCTACAGCCTCGGGCTTTTTG
TTCGTTGGCGTCAATGACAGTACTACTCCAGCGACGTTCGAGGTAGTCACCCCAGGATCACGTTACAACTTGCAGATGGCACTCCCGCTATCACAAGCAA
TCTCGTATTACAATGCTATCAATGTCCCAGCGGGTTACTATTCTATTCCGGAGGGTTCTGTGAATGATCGCCGATTCGAATACAAAAGGTGTCCCACGGG
CTATAGTTGCTCAGGTGGTGCTCGTAAGCTGTCGTTTGTGTTCCCAGATTCGATTTGTGTCGACAGAAATCACATTCTGAGCATCCACGAAAATGACCCT
GGATTTGTCTCGGATGTCAGTTTTAGCCTCGCATCTTCTTCAATCGGTATGACGTATAACCTCCAGACATCGACCACTTCTACAAACCTTTTCAAACTGA
ACGAGCAGAAACATTTAATCCTGATGAAGGCATTAGACTACGAGAATCAAAACGCATACGAAATAACACTCATGATCCAAGAGACCTCAGCGAGTGCACC
GTTTGCGGCGTGTAAAATCCATGTGAATGTGGTAGACGTCAATGAGGCACCCATCATTAGCGGCTACCATTTTGCTCGAGCATTGAAGGAAAATACTCTA
CCTCCCGCAACTCTCATGCCTGCTGTTGGTGTCATTGATCCAGATGCATACGACACGCATACCTTATCTATATCTAGTGGTGGGAATGGCAACTTTGTCA
TTACTCGGGATGGTAATATCGTTGCGATCAACGCTATTGACTATGAAAGTACAACGGAATTCGTATTGGATGTTGTTGCAAAGGACGGTGGTGGCTTGGA
ATCTCACGCTAACGTGGTTATCGTGATCCAAGATATGCCAGAGCCACCAAGTTGTGTATCCTTTTCATTTAATGTGGCTGAAAATACCTCGATTGAGACT
GGGTTGCACAGTTGAGTGGGTACGCATTCGACCCCGATTCCGGCGACCATCTGATATGTGAAGTATTATCTCAAATCCCGATAGGAACAGTTGATGTGGA
TTCTTCCACTGGTAAAGTGACGTTGAAAAAACATCTCAACTACGAAGTCCAGGACACCGTGCCCTTCACGTTCGTTTTACGGATAAAACGGGGCTTCAAA
CAGTGTGTGATTATCGCATCGCTGTGACAGACTCAAATGATGCTCCAGTTCTAACAAGTGCTGTTTTTCGCGTTCCGAAAACTGCATCGGGAACACGTGC
TTGGTAGGAAATCTAGGTACTTTTGCTGTTGATGAGGACAAAGGTGCAGTCCTGACATTTCAATTAACGTCCACGAGCGACTTTCTGTTTGTTCAAGGTT
CTCAGTTATGGTCAAAACCGATGGATTTTGAAACGAATCCTGCAATTCAGATATCAGTTACAGTTTATGATGAAAAAGGCAGCAGCGATGAGGCAACAAT
GACTGTGCAGGTTGTTGATGTAAATGAAGCTCCTACTGGATCACCCTTTACGAAACAAGTGGCAGAGAATGTTCCTGTCGGAACTGTGATTTTAGCGTTC
GACGCAGTCGACCCAGAAGGCGATAATATCAGGTATACAATTGTTCATTCAGTTGGCAAATTTGGGGAGCTTTTTGGTATCAACGGTAGTTTCCTGGTGA
CAATAGCTGAACTTGATTATGAGGCGTTATCGATTCATTCGCTTGGGGCCAACATCAGTGCCTGCGATCCATTCGGCATGTGCGCCGAGATTGGTCCAAA
TCTTGTCGAAATTACAGATGGCCCGATGCGCCTGTTGTGAACCGAGTCGTAGATGGCGTTACCATTCCCGAAACCACACCTGTTGGGGCATCCTTGACTC
AATATGTTTGTTTTCAGATGAAGACACCGGCCAATCGACAAAACTTGTGTACTCAATACACTCCGGTAATCCGCTTGACCAATTCACTATTTCTGAATCT
ACGGGGAAGCTGACTGTGAATTCACAACTGAATGCTGAAATTGTCAGCGAATACTCATTCGTTATTCAAGCCACTGACCCAGATGGGCTTAGTGGGCTCT
CTCATCCAATTGATATCGCTGTCAAAATGATACCCTCACCCCCACAGTTTGTTGGGGCTATTACAGCGCAGAGTATTATCATGTTGACATTAGTCAACTA
GGGGATGGTTCTTATGCTACCGTGTCCTTACCAATACATGACAGAGATCCGGGACAGATTGGAGGAAAATGCTCCATCTCGGCGGACTCAACTGATAATT
TCAAGATTGTAACCAGCAGCGACACCACGTCATGCGAACTATCTGTGCGGCCAGCGCGTATGTACCTGACGATCAACGCGTTAACATCACATTGCGTGTA
ACGGACACAGTGAATTCATCTGCGTATAGTGAAGTGACAATCGGTGTGCTATCACGAAATATTAATCATCCACCTAAGTGCACCAATGCGCACACTCAAT
TGATCGAGAATGTGCCTTACGGTACAGCTGTTGGTACTGTCATAGGAAGTGACTCAGATGCAATCGATACGGTTTCATTTTACATTGCAGCTGGAGATGA
TGATGACGTATTTCAAATAGATTCGTCGAGTGGGGCTATCACAGTGGGCACGAAGGCTCCTGATTATGAGAAAAAGGCGCTATATTCGCTAACGATTCGG
GTTCGAGATGACGCCGCAACCCCACTCGCTGGCACGTGCACATTATTATCGATATTTTGAATGAATTGGAGTCTCCCGTTTGCTCGTTAGGTATCTTTGT
TAGCGCTCCCGAAAATAAAATCAGAGACACGTATGTGGGAGACGCTATCTGGAAATACTGTACAGACCCAGATACAGGGCGGAGTGACTCGACATCATTC
ATCTTCGAACTTGTAGATAGCAGTGTTACTTTTCGGGTTGAGTCCTTTACAGGTCAGATTTCAGCAATTGAAGTGCTCGATTTTGAAGAACGTCCCACCT
ACAACTTAACGCTTATTGTCAGAAATGCATTTCGGCCGGCGAAGAGCTCATTTGTGACGTTAAACATTGAGGTGATCGATACCAATGATCCGCCCCAGGC
TTCATTCCTCGCTTCATTTCCTAGCCTGACAACGATGAACGTAGACATTCCTGAATCATCTACGGTGGGTACAGTAATTGGTGAAGTAGTTGTTTTCGAT
GAAGACGCTGGTGATGTTTGCACAGTGCAGATATCAGACCCCTCTTCAACGTTCGCACTGGAGCAGATAAATTCCACAGTCTATAACGTTAAACTGGTAA
AGCCTCTGGATTATGAGACTCGGTCGTCTTATCCAATAGATATATCAGTATCGGATCAGGCTGAAGCTGGAACGCTGCTGTCGTTGCGTGCTGCTGTAAC
GGATCTTAACGAAGCTCCCTACTTTGAAGCAAATCAGCATTTTTTCATTGACGAAAA