Description :
From Genome Similarity Track
Location :
scaffold_35:293293- 296375
Transcript NameFunction/comments
Plaha_PHALS_01464Ankyrin
Plaha_PHALS_14783hypothetical protein

Sequence
3082 bases(100 bases per row)
CATCACGAATTACACGTAAGCTAATCAATGTGTCACATCCTTCAGCGTCGGCTGAGACATACTCTGTACCAGGTGATTGAAGGTCAATCGGCAAATTTAG
ACGATGCCACCGGACCCACACAGTCCACGCACGAAACTGGTGAAACATCTGTGAGGACGTCATGGACGGTAGGTGGCTGTGCTACCATTTCGTTTTAATC
AATCTTTTCTAATATATTCATCACCTTAATGATAGCAATGGCTTCTAGGGTTTCGAAGCACTCAATCAACTACATCACACCCCTCCAAAGAGGAGAAAGA
ACAGCAGAAGAGCGAAGCTGGAGATACCAACACGTCCACCACATACACCGATCACGAAGTTGACAGTGAAGATGCGGACGATATTTCGACTTACGAAGAT
TCCCATTCAGGCACAACACGATACGAGTTACTAGTTCCGCCGCCGGATGTCGAAGAAGCTCTCCGACGAGCGAAGGCTACGGCTACAAAGTTTGATGTAC
GAGAGCAAATGGTTTTAGCTGCACCAACAAATTCATTTACACGGCAAGAGTTGTCCGAGCACATGATTCCAACATCAAGGTTTCAAAACTATTTAAAGCA
TCACCCTTCGTCAACACTCACCAGGGTCCGAGCTCGATACGTTGACACATTTAACTCGTCCAATTGAACTTTTAAATCTTACTCTCGTCTTTCATCTTGG
TGGGAAATTGAGTCAGAAGAAGACTTACTTTGCTGCCTCTTGGACCAATCTTTTTCAGAATTAAACATACTATCAAGAGTGACACGATCATTTAGGTAGT
GCTTAAGACATAGAAAATCAGAGGCGATGAAGGCTATCAAAAATTTCATGCAAATCTAGTACTTCATAAAACATTTACACATGAAATTGATTGAGCATGA
TTGGCATCCATCTTATAATACTGCACGTTGCGATCTACATACAAAACCATACTTGCACAGAATAGTGTCTCAAGGCTAGAAGGCATAAAGTACTTCAAAC
TCGGAAATTTAATTCCCGCCGACTTGAAAGCCACAAATTCAAAGTTATCGTacccaacgccgacttcagTTTGATTCCACGACCAAGATACCACAGTCTC
GTCCATTTTGTTGTCCACTTTAAGATCTCTGAAGTGTTGTTGGTATCACTTCGTTTGAACCAATGTTCCCAAATATTGCCTAGGACCTATTCATTTGGGC
TCACACCCCGCGACGGAGTTGCCGTGTACCTTGcgaagaggaagctttgacttaaaGATTACACGATACATACGCACAGACCAGAAGCGGACTAAGACTG
TTTATTTGCTTTGCTATTTTCAGAAGTACACATTACAGTTTATGCTTATTAGACTGATGTTATATGTTTACATTTGTTTGCAGCTCCAGTTTGAGATGAT
CCCGAACTCTCAATACGGGATGTAATGAATAAAGTTAAAGTGCCAATCAGCATCAGCCTTAATTTGCGCACGGGGTGATGAAAGCATATCACCTCACTCG
TCTGGGAGCTTACAAGCCAGCTTCAGCAAAACGAGCATTTACTAACGACGCTGTCTCATGTCGGGCTTTACAAGGTACAAAGCCTGACGTGGACACCAAG
GTGACAACTTATCCTCTGAAGCTTCTGCTgttttgcagcggggttgccgtagctttgcgcttagaggaagcgtaacttaggtcaccgaccttccgttcta
tacttataacaagtacgagtttagcggatcgcaatccacttactccaagagaaatTACAACCTTGACCCAAGGgtaattgactcttccgtttaactTCAA
AAtctatattttttatttttatctgcggcaaagccgcctaattttaaatgcatagatctTCCTAAATacgtatagtaaaatctaaatacatgtataacta
ctggctatccagccccgtaccgtattcNNNNNNNNNNGAAACacagtcactgtgaccgcctccgcgagaggatctgctgcaatcccggcaatgagagttc
gcaactcttggacaaagcccaccaattccttgttgccatgtcgggtggcaatgaaaacgcgatcgcacgcgatacccCTGATTAGGTGGCGAGAAAactc
gggagagctgcaTATTCAGCTCctcccaggagggaaacgcagctccgaccgaagtgccacacgtcagttccattctcgcgctcgaccaccgagcttgaga
tggctagcgccacgcgctgctgctcggtCTGTTGCATGGCGtatgcgatggccatttcgacctctctcacccagagcaggagattctctcaatccttccc
ctcaaagaacTTGACGCtgaccatgagcggcttaggtcgggagaagtcatccgtcggtgacggtggcgtcatagacgcaaacgatgcagacatcttctgc
tgcaggtgattTAGCAGCGCGTTgtttcgaaaacgcctctagacgcgcaccgattgcctcggatccttgtgctacaagatgttgcacgccctcaaggcca
agcaagacgtcagctttttaagcccgtcctgcatgccctggggcaaagagaaaaatttctcgatcctcacagaagatcagtctaaacgactcaggtgtag
attgactacaagtgctaccaagtacagcgggctaccgtagcaaacgcttgaggaagcgtaccttaggtcaccgacctctcgttctttaCGAGAACCAAGt
ttgagttagcggatcgcaatccacttactccaagagtaattattgccttcccgaggctaatcgactcttcgttTTACATTCCAAACTggtttttatttat
ctttttatcctaatattaaaagtttagattttcctaaatatactaaatatgtataataaaatctaaatacatgcataactactggctacccataTTCTtc
tttgggtgtgtggtcacaccatgcacatcgtGCGGccttcgtgtaaccccgttacaatttcTCGATTTATAACTTCCGACCTGACCACTTCTATGCAATA
TGCGACAAGTATATAAAACCCCTTGTCAGTGACTGGCTAACAATCTGGGCAATGAGTGATAGTCTGCGCAAAATTTGAAGGA