Description :
From Genome Similarity Track
Location :
contig_58:29320- 34436
Transcript NameFunction/comments
g10394.t1hypothetical protein
g10395.t1hypothetical protein
g10396.t1hypothetical protein

Sequence
5116 bases(100 bases per row)
CTGGCACCCTCAGCATCTCGATCATCACGACGTACACAACGGTCGCTTTCCTACGGGCAGCCCCTTCCTCATTCCCTACCAGTTCAAGCATCAACAACGT
TATTTGGTCGAAGAGGTTCAGGCGGGTTCCGAGGGGCTTAATTAAGCCCGACTTTAATATCGGTGACGTTCAAGTCGTGGAGGAGTGTTCAGCTGGACGT
TTACACCACGTGGCTCACAACACCGTCATGACGACAGTCTCTTCATTTAAAGATTCACATTTCGGATCGGTTGGGTAGAAAACAACGTACATTCCTCCGT
ATATGAAGTGAAGCAAACACCAGTAGGTACATGTATTGGCAATACTGAAGTATTACGTGGTCATTATCGGAAAATAGTATACTGCGGAGATCAAATGGCA
CGACAGTGCCTCAATTAACTACGGCAAGCGGGAGCGAGCGCACGAAGGCGGACCCAGCGTCAAGCTTCCCAACCAGCCCTGCATTGCTGTCGTCATCCAC
ACTCGCGAGCGAAGCATACCGCGGGAGCGCCCAGCCAAGCTGATTATCAACGATGTCATATGGTGTAGGTTTGGGCCATGTTATACACTTCGACCTCGCG
TCATCCATTTGCACAACGCTCTTGGTAAACAATTAGTTGTCCGTGGAAAGCAATACAAATTACTTCTCCAAGTGCTCGCAAGGATGATGATGCGTCTGAG
CTTCGTTGGGCTGCTAGCTGTCGCACTCCTGGCCAGTACCGATACGGCCTCAGCGCAGAAGCAAGCGGAGGTTTTTCACCAGGATCCCCAGACCCTGTCA
CGTTCACTTATCGAGAGCCATGACCAACCCAGCACAAATGGATTTCTTCACTTTCACGAAGATGACGACGATGAAGACAGAGCGATCCTTCCTGGCTCCG
TCATTGAAAAGACCAAAGCGTTCGCTTCTCCAGCCACCACGGAGAAACTCCAGACCTGGCTAAGCAACGGGAAATCCGTCGACGACGTCTTCATTGGCTT
GCAGCTTACCAAGGCTGGCGATACACTACTAGACAATCTGCAGTTCACGACGTGGCTCGTGTATGTGGACGATTTCACTGCCAATAATCCTGGCAAGACA
ACGTCAGCGATCGCTACACTCACCACTCACTACGGCGACGAAGCGGTCGCGAAGATTCTCGACGCTGCGAAAAAGGTAGCGGGGACGAAGGAAGTGGCCA
CCAAGTTGGAGACTGCGCAGATGCAGACTTGGCTGGCGAGCGGGAAAACTGCCGACCGTGTTTTCAAACTCCTGAAACTGGATAAGGCGGGGGACGGCAT
CCTCAGCAACCCAGCCTTCGCGTCTTGGAACACGTAGCGGAAGATTTCCAATAAGGCCCATCCCGGTCAAAAGACAAGTATCTTCGCGAAATTGACGTGC
AATACGGCGAGGTGGGTGTATCTCGGGTAGTCGAAGCTGCATTGAAGGCCACAAGTTCCTCCGCCATCGCGAAAACAGTACAAGCCGAGCAATTCGAGCG
CTGGATGGCCAATGGGAAAACTACTGATGATGTTTTCAAGCTGCTGGCACTTCACAAAGCAAGAAAGAGGCTTCTTGGGAACCCTCTTTTGAATACCTTT
ACCAAATACATGAACACTTACAACAAGGGGAACCCCGACCAGGAAGTCACTTTGATAGGGACGATAACGACTTACTACGGGGATGTACGTCTAGCCAAGT
TACTTGCAGCGGGAAGGAACGTCCCGGGCACGTCGAACATCGCCACAAACTTGGATGCTGCGCAGTACAAACTCTGGATGAGCGGGCGGAAAGACCCGGA
CGATATCTTTACGATGTTAGGCCTAGAGAAGGCTGGGAATGGCCTTCTTTCCAACCCGCTATTCACCACGTTTACAAAGTTCACGGACGCCTATCACGCC
AAGCATCTTGACATCAAGATGACTACGAATTGGATTGTGAGGACCCACTATACCGATTTTGACGTCACTAAAATGATCCTTGCAGCGGAGAAGGTGCCAG
TGCCCAGAGCGCTGGAAAACGTATGGAGGCTGTACTGTTCAAAGACTGGATGAAATCTCCGGATAACGCGTTCAAGGCACTCAAACTTGAACAAGTTAAT
CCCTCAACGCTGTTCGAACGCCTGATGTTCGCGTATTGGATGAAGTTCATGGATGATTTCCACAAGGCTTTCCCCGGTAACAATATCCCTCGGACCGTTC
TAACGACGGCCTACAAGGACGAAGATCTGGTAAAGGTGGTCGAAATGGCGCAAACGAACCCGAACTCGAAGGATCTTGCGAACAAGTTGGAGATAGAGAT
GTTCAAGCAGTTCATATTCGCAGAAAAACAACCGATCGATGTTGCCAAACTTCTACACGTTAGTGAAAAGATCGATGCGAATTGGAAACTTTGGAAGAAG
TACATGCAGGACTATCACAAGCACCACCCGGGAAAGGTCACGATCAAGTCGTCCACGTAGTTCCGAGAGTCCGTAGATTCGCGTTTCTTGTAAAGCACTT
CCGTCGTGCTTTCTCTTCTCATGAACGTAACATAGCATATAATCCTTGATAACCTGGAACTTGACGTAAGGTGTCAGGTGTCAGGTGTCAGGTATCAGCC
TTAAACTACACGTGGATGTACCCAGCAACGTTGGAGGCCATAACCATAACCATACCTTGCTACTTATGTGCTATCATAGCTACCCTTTTCGACGGTGTGT
GAGAGACCCTACTATGCAGATTCAAGTGAACAATGACTTTAGTGCGCTGTGTAATTGCCAGGAGGTGAGGCAAGTCCTATTGTAGTTTTGCTGCACGCCT
GGTGGAACAGGATTGATTGGTGTTCTTGTTTGTTCCTCTGTCCGTTGCATCTAGCTGGGAGCCAAGAGGTTTTATGGTCAACCCGTTACCAAGGAATGTC
GACCGTCCCGAACGGGTATTCGCCTGCGTTGGGCGTGGAGTTCGAGCAGAGCGAGCTGCGGATTGTGGTCTTGTTGTACACATCACAGTCGGTCTCAGGC
TCGATGGCGACCCAGAACTCGCTGTCTCCGCATCTTCTTCAAGCGCTTGCCGATATGCGGGTGGTACACCCCCCAGTCGTCAGCCGTGAGCGTGAACTGC
ACGCCCCGCGTCTCACCTACTTCCAGGCGGATTTTGGAAAACTTCTTGCGCTGCTTCATCTCAGGCACGTTTGAGGAACAACATCACGGCCTCTTGCACG
ACATCGACCCGCTGTTCGTCACGTCCATGGAGACGGTGGTCGAACTATTCGGGTCCTAGATCGTGTTCTTACTCAGGGTAACAGTCGAGTACGTGAAGTC
GGTGTAGCTCAACCCCGTACCAAAGCCCCACTGATTTTCGCAATAGAACGGATCCCCAGTATGTTCTTACACATGGTTGGCACGGGGTGGTTCTACACCG
TCTCAACGTTAGCGAGGTCCTTCGGGTACATGATCAGCACTAGCCGAGAGCCGCCCGAGTTGCGGGCGGTGGGTGCATGTTTAGTTGGTGCCCGTTCGCT
CGCTCTTCCAGCTCACTTCACTACTATTTTTACTATGACAGGGTTATGTTTTATCTCAGTATATTTACTTTTGACTTGAACCACAACCCTAAGCCCGCTA
CGGCTCGCAAGCTTCGCCTCCGCTTGTCTACCATGCACTGCTTGGTCCTGGGTTTGCACCCGCGTGCTTCGCACACGGGCTTCAAACCACAGGCATACTC
GCTGCGCTCGAGGGGGAATGGTGACTCTCAACAATTACCGCTATGCAAAGTGACAAATGTATTACTTTCGTAAAATATGCATTCACACGAAGTCGCTGCC
TACGCCCTCTCGAACAGCTGTCGGTACACTATGTTCGCCGTGTACACTCCGTCTTCTTCCTCCCGCTCTGGATACTCGACCAACGCCTTGAATCTCGATC
TTGACGTAACCCTTGACATGGCCACATACAGCTGACCGTGGGAAAAGCAAGGAGTCGCCAAGTACAGTCCCAGGTACTGCACCGTTTGTCCCTGCGCCTT
GTTGATCGTCATGGCAAAGGCAGTCTGGATAGGAAACTGCCTGCGTCTCAGTCGAAATGGGAAATCGCGGATGTCGCCATCGCTGATGAACACGATGCAC
GGGATCAACACATGCTGGCCTTGCCTGTCGCCGGCCATGATGGTGGCATGGATGACATGATCTTTGAGTTCGACGATTCGCAGGCGTTGTTCCGTTGCAC
AACCCCAGGTCAGGATTTAAGTTCCGCATCATGATGATCGGCATCCCCTTCTTGAGTTTCAGCTTGTGGGGTGGGATGCCACTGATGTTCAGGGAGTTTC
CTGCTTGAATAAGTTCCCGTCCTCTTCATCCTCCACTGAGTCTGTGGACACATATTCTTGAGATGGCCCAGTCATACGATCCGCTACGGCTTCGTTGATA
CGATGGACTATCGCGTTCGTGGTGGTGAGGATGGTGCGACTCGCAAAGTACTCGTCCGATGCGACTTCCGAATTGTTGATGTCGGCGTACATCTCGTCGA
TCATGCGCCGCATACCTCGCGGAATAGCTCCCGGTCGGATCTCCTCGTCCTCATCTGGATCACCGGCGGGGTTGTCGATGATGGAATCTTAATGTAGTCA
TTTCCCAGATCATTGTGTACCTCGTGTCTCTCCTCTCCAACGTTCAGCAGGTACTCAGAAAACGCAGCCATTTCTGAAGCACTATCGGAGGTGGCAGCCG
TATGTTCTTTGTCAGACGCACCTTATGGAAAAGTGGCCACCGTTCGGATGACTTCAGGCATGCGTCGATTGTCTCTGTCGCCGAGCCGCCCTTCACCACC
TGGAGAATTTGCCTGGAATCTCTCTGAAACTCGACCACGTATGGGAATGAAAAGAAACGTTGTTGAAAGGCGGTGTATTTTGTCCAATCAGCAGTGATTT
CATTCGGCTACTTCCGATGTGATGTAGTCCACTCTACGCATTATAATAGCCAATCGCGCAGAAGTTCCACTATATAGCCAATGAGAGGGCTCACATTATA
ATAATAGCGAATGGGGAGGCCGCCTTCGCTGCGCTCGGCAGCTATTTATAGCCAACGGAAAGTCCGGATTTGCGTTACGCTCCGGGTGCGTACGGAATGA
CGGACAGACGGACGGA