Description :
From Genome Similarity Track
Location :
Scaffold_1432:2932- 4273
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1432-fgenesh-gene-0.0Cysteine protease family C01A

Sequence
1341 bases(100 bases per row)
CAGACCGATGACCGTGAGCACGACGGTGACGCCTGCTACCGCGATCGCAATGATGAGCCACACGTGGAGACTCATGCCCACGAAGAGCTTCTCGCCGCCG
CCGTCGACTGTCGTCATCGCCACGCCTGCTTTCGCGCCAGTGGGTACGACCGGAAATAGGTTGAGTCCGCAGTTCGCCTTGCTATCCGCCAGCAGCCTCA
TGAATCCGTTCTCGCCCCAGGAGTTGCTGTACGAGTTCTTCAGAATCCAGTAGTCGCCCGCCTGCGCGTCCGACCCGTAGCCGACGAGCAGGAGCGCATG
ATTCACGTCGTTCTGCGACGCGAGGTTCCCGTTGTTCGGACAGCTGTACAAACCGCCCTTGTAGTCGGCGAACGGGTACTCCGCGTTGAGCGCGACGGCG
ATTGGCTGGGTCTGCAGCGCATTCTTAAGCAGCACGTTCGGGTCGCGACTCAGCGAACAGTCCTTGCCGACGACCTGCTTCCAGTCCGAGATGCTCGCTG
CTGCGGCTGTCTGATTCGAGGCGTGACCGCACGTGGTATTGGACCCCAAGCTAGAATTCGGTGTGGAAGTGCTCGACTTGTCGTCATAGGGCAGTTCGAG
CTCCGTGACGAGTCCGTAGCGCAGCTGCGCGGCGTCCATGAACGCGCCGTGGGTCATGCCGCCCGAGCACCCGTTGTTGACCGACCTCCAGCGCATGGTC
ACGCCCATCCAGGACGCCCACGAGGGACCGTTGCCGCTATTCTGCAAACTGCCGCTGCCGACCCAGCAGTACGTGAACGTCTGCTCGGTCTCGCGCCTGC
TGCACGAGAGGAACTGCTGTGGCGCAAGCGCGACCGCGACGCTCTGGTTCGCGGCGATCGCGACCGCCGTCTCGATGGCGTCGGAGGCAGCGAACGCCCA
GCAGCTGCCGCAGTTCTTCTGGCTCTTCACACCCGAACACACACTGCGGTTCTCCGGGTTCTCAGCAGTACACCAGTTGAGTGCCGCGGGAATGGTCGTA
TTGGCTGTGTTAGCCGTAGTTGAGAGCTGGCGCACCGCCACGCGCGATCCGCTGTGCTTCATCTCTCGGTGCACGAATGCCTCAGGTAGGTACGGTCGGT
TCTTGGCGATTATCGTGTCGCTCGCGCTCAGCAAGTGACGTTCATGGACGCCCATCTTGTAGGAGAACGCGTGCCCCACGCTCTGCGCGTATCGGTGAAC
TTGCTCAATGTACGTCATGTGAGTCTGCAGGTTGTGGAGTGCAGCGTCTTGGTCCAGGTCGCCGATGTCCGCCTCCGCGAGCAGCAGCCTCTGCAGCATG
TGGGCGTCGACCACATCGCCGCTCTCCCCCATCCAGAGACA