Description :
From Genome Similarity Track
Location :
contig_15:293177- 305458
Transcript NameFunction/comments
g4215.t1hypothetical protein
g4216.t1XP_009516806.1 hypothetical protein PHYSODRAFT_309854 [Phytophthora sojae
g4217.t1hypothetical protein
g4218.t1hypothetical protein
g4219.t1RAW33169.1 hypothetical protein PC110_g10495 [Phytophthora cactorum
g4220.t1KUF79267.1 serine/threonine-protein kinase [Phytophthora nicotianae

Sequence
12281 bases(100 bases per row)
GTCCAGATAAATCCCCAAACTCCTTCAAGATGTTCTGTACAATTGGGATTTCCTTCGCCCAACCAATTATCATACGTACTTATACCTGGATAGTTGAGGT
GTGAGCTCCAACTGTAAGACGATAGGACAAACGAAGCCGATTCTTAAGTGACATCGTACTGAAACCAAGCATTAAAGGTACACAAAGTAAAATATGTTTT
GGCACAGGGTGGCTTAACTCTACGACTGTATCCAAAAAGGCACACGTGAAGTGCGTGCTGTGATTATGGACGTGTGGAAAAGACTTTATTTGGTTCGAGC
CACTACTATTAATAGTGTTCCCTTTATCTTCGTCAACAATGGCGGCTGTCGTGTAGGTTGCATTGCTGCACTCAATGGTGATTATGGGATGCATGTAAAG
ATACACGTGAAGTGCGTACTATGATTATGGGATACTACACATTTACTGTGTACACATCGTGAATCGCTTGAGAATCTGGAAATTATTTCGTTTAGAAGTC
CTTGGCGAATCCTTTTATTAAGGGCAGTGGTCATTTGTGCCATTGCACGAATGGATAGCTGAGCAGTCTTTTTAACTGTTATGCTTGGTCGTGAGGGATC
CGTCGGCTTGTATCGATTTTCGAGGTAGTTTCTTAGCCTGAATACGGTAGGCGAGCGAAGTGCGTTTTGGACCGCAAGCGCAATAATGGGAAACTTGTCC
AATCCTTAAAATACAGGTAAGCTTCTAACCTGGACAGCCGATCAGTGTTTTTTGTTTGTAATTTGTATTACTCGTGTGGTAATGCTCTAAAAGTCGGCAA
CCAGTTTTATAGTGCAGTCTGCCGAGCCATTTATAATACTATTTGTATTATACTATTGCGAGCTCCAGGACTCTGCATCAGTTGTTTTGCAGCAAACCTT
TTGCTAGAGCCACCGAGTTTAGTTGTTTTGCATGGCCTTTTCACACTGAGCAAGAGTCAAACGTTTCCGTCTTCATCCGCAATCATACAGTTCACGAGGG
ATTGAGAGCTTTGCGTTTCGATCATCTGCCCTGGCTGAACTACACAATGTGTACACATGCTGACGCGAATCATCACGCTTTCACAAGGGCTTTGGTCAGT
TCGAAACTTGCGCTCCAGAGCCCAAGCCACACTGCCCTGCTGATCGACCCGGACCCACCATGCGCTTTTGCTACCTCGTCCTATTGGCCGCAGTTACCCT
CTTGCAGGCGGTAATGATGTTGCAGCCAACACCGCCGCGGACTCCAAGCAGCTTGCTCAGCTGGACGCCATTCGCTTGCTCGCTGAGCAGAACGAAGTCA
ATGTCGCCGTCAACCGCCTCCTGAAAATCGTCGACACGGAGGACGAGGATAGAGCGGCGTCGGCGTCTTTCCTTACGAAGCTCAAGCAGGCTGTCTGGAG
GATCAAGATTACTTCTTGGTTCCAGGCCAACAAGACCCCGGCGCAGGTTAACCAGATAATGCTGAAGCAGGGCAGCAAGATCGACTGGGCTCTGGCTACC
GCGTATGCATCGTACTTCCGCAACATGAAGTACGGCCCCTTCGCTATCGACATGTATGACAACGTCAACAGCAGAAACGCTTAACTTAGTTGTTCGAATA
GGGGTAAATGCCATGGAGCCCATGGCCCAAGCCATTGATAGTCGAGTTGCGCACATATCATTGGTAATTGAATGGACTTGTAACCTGAAAGTAGCAACGC
TAAGAGGCGAAAGCCGGCATCAGCACAGACAGATAGGCATATGTGGGGGAATACGCGGAAGCTTCTACGCGAAAGCTTGTAAGCGAAGCGCCCGGACTAC
GCCGTACCACGGTAGCCACTACGGTCCGGCCAGTCCAGCATACTCCACCTCTGTTGGGGTTCCAGGCAGTTCCAACCTGGAACTGCAGCAGAGATGAAGT
TGACTGAGATCCAGTGCCCCATCGCGCATTTTTCTCTTCCCCGATTTAGCTCAGGATCAATGATAGGATTCAGGATGGTATCGAACCAGATCCGAAAGGC
GATCCCAGCTTGGAACGCATATTGCGATTCGGAAACAGATGGACTAAAATGGATCGAAAGTGGACCGCAGCGGTGCATGCATTCGTTTCGGTGTCACTCT
GCCATGGTCTGCTGGGTTTCTGCAGTTTCAAATTTACATTTGATTTGCTATAAAAACTTCCTGTTGCCAGGCTGCATCATCCTACATGTTCATCCAAGGG
CGGCCTCACAGTTTTTGACATGCTTGCCACTACAGTAATCTGCGTTAATATAATACATGTAGAACATCCAAATACACCAGCGCCTTGTGGCCGATGTAAA
CTTGTTTCTTCTATTATCTCTTCGTGCCCGGGGAATGAATACTACATGCATTAGGCACTACCTACAGCGACATGCTCACAATTTTTACCTGGAGCAGCAT
GCTCACAATTTTTACCATACTGCTCACATACCAATGGTAATGGGTAACTTCATACTGGATGGACACGATGTACTTCTTGATATGCCCGACACCATTCCCT
TTGACCGCTATACACACCATTCCCTTTGACCGCTATACGATTTTTATCATTTCATGTATACTGTAATACTTCTTACCGACGCAACTTGCGGAGGACGTAC
AATGCAGCAACCAGAACAGATACCGATGATACTGCTGTGCGCATTGACGCGGATCCCCTATTCGTAGCCTGGTCAGAAATCTGCGGTGTCCCGGAATTTC
CATTTCGAAGCAAATACTGCCTGGCATAACGCAGCAGAGGCACTGTACGCCCCGAACTCCACTTCAAATCCAACAGTTGCACAAATCGAAGGAAAATCGC
GCAACAAGCCACCGAACTCAACGCTGACGCTGCAGCAAACTGCACGAACGTAAGGAAAGCTCTGCGACTCCCTCGTGACGCATACAACTGCATCACCAGC
AGTGCACTTGAGATCGCAGCCGTCCGATTAAGCGTCTTCGAACCCGGCATCTTCACCAGCTCCTTGCATCCGTTCCACATTCTCGACGTCACAATCTCAT
TGAGGACCTGCTCACGCGTCGGTGGCGTACGCACAGTACTAACCACATCTGGGCGATGGAAATCGAAACCTGACGTCGGCGTTGACAGCAAACTCAGCAC
CTGGTTGTGTTGCGCCTCAACTTGTTCGTCCCCCCGCTCCCTATTTTCCAGCACAGTTAACGCTCCGTCGCCTGAGTCTGCACATTCACCCTTGTCTTCG
TCATGGTCACTACTGTCACTGTCCTCCGCTGGAAGTAAAACTTTCTGCACGGAATCCGGCAGCAGCGGCAAAAGTCCGGGTTTCGTCAGCATGACCTGAG
CCTCTGGCGGCATCTGCTCCATCAACCTCATCTGCTCGGCCCTCGTCAGCGGCAGCAAAAATGGCACAAAGGGTGCCACTTTATCGGAAAAGCTTGTATC
TGTGAGCCACTCCAAAAGTGAAGTTTCAAGTAAAAGTTCCCGTGTAGATTGGGGCAGGAACCCCAGCAGCCCTTTTGTCCGCGCTTCTTCTTGGTACCAT
TTCCAGACGGGAACACTCCACGAGTACAAAAGCCCCAGCGAGGCGTAGGCCAGCGCCACGAACGCGAGCATGGCTCTCCTGGATAAAAACTCAGCGAGCA
GTACCGTGAGTGCAAAACTCACGGTGAGGCAGCTGGCGACACGCAAAAGCAGGAGCGCTGCCTCGACTTTCGAGGACACTTGGGAATACGCGATATGCAC
CAGCAGCAACCAGGTCAGAGGCGGCGAGATGGCGACAAACACGACGAGGTGGTCAACCGCGAACGAGTCGAAGTCCAGCACCCACCCGTTGTTTGAGGGC
ACAAAACGCCTCAAATAACGTCGCGACTCGTCGTCCAGCCACGGCGCCAACGCGAGCAGCGCGAAGCTCAGCAGTAGCAGAACCGAGCTCAGCGCGAGCA
GCTGTACGCTCAGCGGGTGTCCGAAGCTGCGCCGCAGCACGTGGTCCAGCACGCGCACGTACAGCGGCCGGGAAGACGTCATGGGCTGAAGAGAAGAATG
TGTGGTTGAGATGACAGATCGGGGTTGTATGACGGAAGGAAGGTGTACCTCCATTCTGTCATACAACCCTCATCTGTCATCTACTGTACACTTGCTTACG
TGAAAGCGATGTTTACGATGTTGGCAAGACACATCTTGTGATTTATTGTGGTTTTCAACCTTTTTGCCGCCTGTTTTAGCTCCGCATCTCGGAGTGGCTT
GTTTTACAATTCGGGCCTTCAATAGGGATAAGTCACTCTATCTTGGTGGGCCGAACAGCTCGATCACATACTCCTGCTCATTATTGCCCCTTTCGTCCGC
CACACACTTGAGACGTCGTTTACGTGAATAAGGGCCACAGTCCGCCATCTAAATTCGTCCGCGTAGGTTATGGTGCTGCGAAAATTGTGTGAATGGTTAT
AGCGTGTTGGTGGCGGGCTGAAGCAGGTATTCCACTCCTTTATATCGTTCATAAGCGGCAAAACGGAAGTGTTGTTTTCATTTATGTATTTTGGCGAAAC
GGATGCCTCCGATCCAGAGATGCGGGGTCTGAGATAGCGGGCATCTCAGAGATAGCAAAAAAGAGGGTCCGCAATACTGGGAGGAATAGGTTTATTAAAA
AGCTGTGAATTCAACCCGACTTAGCACCTACCGTTTTTGACGGTTTCAGACGGCATCAACGAGTGGTCTTCCTGCTTCAGCCCACTCGCACATTTTTCTT
TCCACCATGACGCTTGGAGACGATTTTCGCTGGCGAGCCATAGCTTCGATGCATGTCTACAACGTGTTATCTGTGTACGTTTCAGAGCTATTTAGACCGA
AACAGCGGACGCTTCGCCGTCGGGCTTGGCTGGAGACAAGTCTCCGACTTGGGCTATGAAATAAATCAACCTAGCCCCATGCACAGGTCCGAATTCAAAA
CTGACCACTCAGAGTTGTCCAGCTAAAACGGGCGGCAAAAAGCTCGAAGAGCACAATAGTTTCTTAGCTAAACACAAGTACGCGTACAACATGTATTGTG
CTTTGCAGCCAGTTTGTCCAGCTATTTCGTGCATTAGTTAGTACTCGTACTTAAACCATAGAGGCTTTGAGTGGGTCTTTCCGAAGTCATGTTTCATGCA
CGACAAGGGCAGAAAATGGCGCTGTTAGAATACTTTCAGATCTCCCAGACACATAATGGGCGAGTATGAAGCATGCACGATTTACAGCAACTCGAACTCG
AGTACGATTTATAGGAATCTTGTGCAAGACAAGTCGTACGAATTGCCAAAAAGAATGCACAATAATAGAGGACCGAGTCTTTTAAGAGGTATTTTAAATA
CAGTACACGTAATAAATACATTGGAGGTACCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGAAGAAATGTTCCCGATGACTGTAAAGTTCGCCCAATCCTG
TTTACTATCGCAGCAGAAAGCATGCAGTGATGAGAAAGACCTATTCCCTCATTGCTCATTGAATTGATACATAGTGTGCCGACATCAAGCCAACAACTTA
TTTTAATAGGCTGTACTACATGTAGTACTCTAGTACAACCTATGATTGATCGTACTTGTCGCGATGTGGGACCCGCACGCAAAAGTATCTTGCTCGTGCC
AAGCCACATTTCTCCAGTTCTTTAGTAGAGCTGTGCGCTGAGCGGAAGCAAAGCCTCAAGATAATTCAAGGCAGTTCGCACATGGGAAGTTCGTTGTGAC
CATCATGATGCAATGACGCTCATCCGAGGTGCCTCTCGCCGCAAGAGTCTCGCACCGTTTGTGTGGTACCGTTTATATCGTTCTGCAGCTCTCGCGGTAA
AATTTGAGATTACAGCCGTTGAGACCTCGATTATCGCAGATCGAGCGAGATGTGACCCTGGGTTTAAGCCACAGGCGTTGTTTAGCTTCGCTAACATAAC
CTTTATTGTACTTTTCATCCATTTTGGCAAACTTGAGTTCCATTCCCGAGATAAGGGGTCCGAAATAGAGATAAGCTCCGAGATAGCAAACGACTAAGTC
CGAAATGTAGCAAGGGGGAAGGTTTGCTCTGCTACTGCATCCTGTTATAGAGGCTTACATGCAGTCCTGGTTTAAATACACATGCTTCGGAAACAACATT
TGTTTAATGGACCCCGTAATCACCGGAGAACAAATCAATTGTACAGCACAGACTCTTCCGATCGGTTTGCCGACGTGTGAAACCAACCGCCTTGTGAACA
ATTACGGTACATGTACAGATAACGACGGATCGTGGGCCGGCGGTACCATGGTGCTTAGACCTCAGTTTGCAATTTACTCTCCACTTCACAAGCACCCGAA
CACCAAGAATCAACACTTAGCTATGCGCTTCTTCTACGTCACCCTCGTCGCTGCGGTCACGCTTCTTGCAAGTGCCAACGCTGTCTCCACCAAGCAGAAC
CAGATCTCCGAGACGTCGCCGGAGATTGTGGCTCGCTCGCTCGCTGCCGCCCAGGACGACGCTGCTGTCAAGCGTAACCTGCGCAAGTACGTCGAGGAGG
ACGACCTTGACTCCCTCGACTCCCTCGACTCGTTCGATGAGACCGAGGAACGCGCAAAGGTGATCAATGTGAAGCAGCTCAAACAGCTTGCTAAGACAAA
GAATGCGCATCTACCGGTCAAGTTTGAGAACCTGAACGCCAAAATGCAACAGAACATGGTCAGTTCTTGGGCAAAACAAAATATGAACCTGAAGCAGTTC
GCCAAAAAGCTGGGACTAAAGAGCGTGAACGACGTCGGCAACAAGAACTACCCGGTTTTCAAGATGTTCGAGGCGCGGTTTACCTAGTCGTAGACGCACC
CCTTCGCTAGGCAACCACGAATAACCGATTTTGTAGCCGACGCTTAAATCACTTGTATCGAGCATTCATACAACAGTTTGACGACAGTGCTAACTAAATG
ATATCACCGGTCAATAGTATCCGGCAAGCGCGACAAAACTGAAGCAGAGCGTTCAAGTAAGTGCATTTATGCTTGGCGTCTTCTCTTCCTCTGTCTAAAT
GCTAAATTGCGAGCGTTGCTGCTCTGTTCGTGTTCTGTCTCCCTAACTAGATGAAACATTATGGTGATCTTGAGTTGTGTTAACCGACGAGAGCGACGAG
AAGAGCTAATCAGCAGACCGTTCACCCCAGTAATACACCGCATCGCTGCCTGCTGTACAGTCATAGAGGTAGGTGGTTGCGCCCCAGTCTCGCGTTCAAT
TGCTGCAGAAGTGTGCTGCAGCATAATTCGCCACTCTGAATAGGTTTGCCGCTTTCTCCGTGTAGGTAGATCACCTGCGCCTGCTCCTCCTTGGTTGCGC
TCAGCTTCGATGCGCTTCAGACCGGCGAAAAATGTTTTCATGCCATCAATGTAGGCAACAGCGAGTGGCAGTTTCTTCTGCCGGAAGACGTCTTTAATAG
CACTTCGATAGCCGCTGAGGGTTGTAACCTTGAGAGTTTTTTCAGTATCGTCCGTCTTAGCTAGCAAAAGGCCTCACAATCTTTCGGCGTAATACATTGG
CGTCAATTTCACCGTTAGAGTCAAATACCTCGCAGAGTCCGTCTTAACCGCATGGATCCATGCAGAAATTCCGCGGCGATAGCTGCGGTAAGCCGTTTGA
GTCCTGGAGGTTGTACATGCGCGGCGAACGTTCTCCGCGTTGAAAAACTCGGTGGGTGGCGTTGAGGAGCTCGGAGTAGCACCATTGCTTCTCGCAATAA
TGGTGGGGTCTTCAGGGGAGGACAATCACGCAGAACGAGATGGGGGCATGGGGAAATGCTGGGGGCTGAGGGCTGAGGGCGGGAGCTGGAGACTATGTGA
GGTGCTCTGAGCGATTCTAGCCAACGATATAGCCCAGTCTATCGTACGACGAGTTGTCGTCACGCTGTCAGACGGCGGCTCTCAAAAGACAAGATATGTC
TTACGAAGGCGCATGAATCAATGATGCTACAGTAGGCAATGCCGCGATGATAATACGGTACCATAGTGTTGGAGATATTCTGGTGGATTACATGTTATGT
TGGTCGCAGGAAGACACATAGTGTGAGCAAGAGCTTGCTGCTCTTCTTTTAGCAGAGCTGCGCCAAACAAAGCTCTACATGTATGGGGATAACAGGAGCG
GCGACGGTCTCTACTTGCTTGGTACCGATACATGTAGCGTTTTGTTGTCACCTGTGTGGCGACGATGGATTTGCCACTCTCTGAAAAGCAGCGAACTGAT
TGTAACAGCAGAGAAGCAACATTATTCATCGTCTGCAATTTCCACAACGAATCAATTGGAAGTTTCCAATGAAGTCGTCCCGCAGATGGCATGCAGTGTT
CAACGTCGAATTTTGAATCGATGTTCAACCTAACTTGTGTTGGTACAGATGTCCCCTCCAAATCTGCAATGGTCGGACCAATAAAGACTGCTAGGTTACT
AGATTAGCATAGGAATACATCAAGAGCCAAATGCACTGCATTATTCCGAACTACACGACTAATAGCAGAGCATGTGTGCAACCTGCATGCATGCATGCTT
CCCCAAGACCGGTAAATGTAACTTAGATTAGTACAGCATCGCGGCAGCCAGAGCAAATCTTCCGCAGATCCATACTATCTGTGCAAGGTAAATTGCTGTA
CGCAGTTCTCCCTTTGCCGGGGAACTCTGTACATGATTTGAGAGAGAGAGAGAGAGGTCAGACTTGTCTATTTAACTTTACGGTTTACAAGATGTCTGGA
ATTTTCAAAGCCAGGATAGCAACGCCGATATCGGTTCTCGCCCGGTGGTTGTACTTGACTCACCGCCGATGGTGGCGCCTCTTTTGATTGTCTCGACCGT
ATTTGTAGACAGATGAGCAATCGTGTGCCCTGAATTATGGTGTGCGGTCTTCTTCGTTCTCGTGTTGCCAACGCACGTATGTGTCTGAGTCCAGCGTTTA
GAAATTCTTGAACGCTTCCGTGCAGTGTGACCTTTCCACCGTCGTGAACGACTCGATTGCGTTGAATCCATAGTACTGTGATGCAGGTGGAGCTGAGGAT
CCACCATACCCTTTTCCAGTCTCCTTCATACTGCTCCGGGTTATCCGCTACTGTTGCCTGGAGTCGCTGCCGGATCGCAGCGGGTATCTTCGGCGGTTTG
CGTGATATGCAATTTCCCTTGAAATTTGCTTATGTGCTGTTGTGCCCAGTCTTGCCCTGTCCATTGACTGATGAGCGCTCGCCAGCAGGCTTGTGCAGAC
AAACAGTCCCAAATGATGATCCTTATACGTGTTTTGCAAAGGGGCCAGAAAAAAATGTTGACGTTGAAGCATATGAAAAAATTCCGCTCAATTGAAGACT
GGCTTGTTAGGCTCGGTGAGGTTTCGAGCTGATAAGCGCACAGAAAGCTTCGACTTGATTTCAATCGATTATTTTCTAATACTACGTGTGCAAGAAGAGC
CTTCACAGTCTGAAGAAACCTATCTCATCTCCGACTTGGCCTCATCAGTCGTAAAAAAGGCTGTGTTTCCTCCTGTAGTAGTACACCTCGTATCCATCAG
CAAGATCCCAGTCGACGTAGCGACCTTGCGCCTCCCGGTTCCGCAGCATTTGTTTGACTTCTTTCGGGTTCATCCCTGAGCGATACCAACCACGGTACGT
CGTTTTCGCGGCATACCGATTAACCAAGTAGTCGAACAACCCCTTCTCCTCACTGCCGTCTTTGGCGTTTTCATCGTCCTCCTTGCCAACGCTCTTGTCA
GCCCGCAGGCGTCTCGTGCTCTCAACATCAGCAGCGAGGGCACGGACAGAAGCCACAGCGTTAGCTGAAGTCACTTCGCCGATGTTCTTTTGGTCAGAGG
CCGAGACCGTGTTGCTGCCCGCAAGAAGGACAGCCGCTGCTGCTAGAACGAGGTAGGTGAACCGCATAGTCGTTTGAGATCGGAGCTTTTTGAGGCTGGG
TTGCTTGAGCTCTGTAGAGTGAATTGCGAAATGGAAGTTCGTAGGAAGCTACCGCATAGGAATTGTTTACACTATCCGCGAGCCGTCTTGCTGTCCGCAT
TGAGCGTGTAGGCAAAGGTGCGGGCTTCGCAACTGCCGGCAAAGCTCATGATGGCAGCCCAGGAAACGTATCTTTTCCCCTGGTCTAGAAAAACGGCTGG
CTTGGGCCTGGGAAGACTTAATCGCACTAATTCACAATTCACAAATTTAGTGTCGGTCAATTCCGACCCGGAAAATGGCCGCGGAGCGCAGCCCGCAGAG
CCTCTGGCGCGCGGCGGCAGGTGCGCCCGCCACATTCCTCACACCCTCCCGCATCTCCTCTCTCCAACGCACTATTTGCACGCTCCAACCTTTTGTCCCA
TAGAGAAATTGGCCACCGCCGACTTCCTCCTCGTTGCCACGGGCGCAGGCTTTTCGGCCGACTCGTCGCTGCCAGTGTACGCAGACATCGCCAAAGTGGC
GGCCTACGAACAGATGGACGTGGAGTACCAGGACCTGTGCGACCCGTTCATGCTGGAGCAGGACGAGGAGATCTTTTACGGCTTCTGGGGCAGCTGCACC
AATTCCTACAGGGACGCGAAGCACCACGCAGGGTATGAAATCCTACGCCGGTGGAGAGACGCCATGAAGGCGAAGGCTACGGCCACTACAGGCAGCAGCC
AAAAGGAGAAGCAGTCAGCTTTTCGAGCGGCTTTCGAGCGGCTGAAACAGTGTGGCGATCTTCCGAGAGGAGTCGCCACGGATTCCGTGACGAACGACCC
GTTCTTCATCTATACGTCCAATGTAAGGTGCTCGTTAGGGTGAAAGGAGACGGCTGTTAATGCTGGCTTGTGGCAGGTGGATGCGCACTTCCGGCGAGAT
TTCGACGGCAAGGAGATCTACGAGCTGCATGGAAGTGTCGAGACGTGGCAGTGCGCGGGAGACGTCGAGACTGGCGCGAGAGAGCCGTGCCACAAGATCT
GGAAGCTGCCGGCGGACTTCCGCTTTGATTTAGATGTGACCACAATGAGAGCGCCGGGCGCAGATGCGACCACGTGCCCCGAGTGTGGAGGCAAAGGCCG
CCCCAATGTGCTCATGTTTCATGATAGGCAGTGGATTGGAAACGTGTCGGAAGAGGTGGGTGTGCTGCGAGGGATTGGCGAAGGAATGCGTGGCAGGTTA
ATGCTCATCTATGCTCGTGCTGTATTATGCTGCAGAATGGCTACATCGCGTGGGAGGCGGTGATAGAGCTGGTAAGTTGCTGAGCAAGTTATCGTTATCT
ACGTGTCTGCTCATACTACTTGAATGTTACTGCTCTACTACGTGCTCTCATTGCTATAGATGCTGCAAGAACACCCGACGCTCAATCTAGTTGTGCTTGA
AATCGGCTGTGGAACTCGGGTTGGTGCCATATTCGCTCTAGGCACAAAGGCCGTGCTGAAAAATGTCCTCATTCTGGTTTTGGTGCTTGCTCTAGGTGCC
GTCTGTCCGGAAAGAAACAGAGATGGTTGTCGCGGATGTGCTTCAGGCCTGCGGTCGTCCGCAGGCGACGCTCATCCGTATCAACCCAGACATCCCAACT
TGCAACAATCCGGTCATTTTAGCGAACGACCGCTTCCTTTCCATCCGTTCAAAGGGTTTGGAAGCTTTAGAAGGCATCGATCAGGAACTCCGCAACCTTC
GACCAAAGGTATAATGGTAACAACGTTTGAGTTAGGGCACCACGAGAGCGGGGCAGGCGACATGATTTTATATCGCGACGGGATTGTGGGCATCAATATT
GAACTCGAACCCCGCGAATTTTTCCTGGTCTTCTGACGCGATTCGATCTGATCGCGAGTTTACATTGAGTACGTCATCGAAGTCCTGAGCCGCTGTATCG
CAGTTTGCCTTCTTTTCATCCACGACGGGGACGAGAGGTGGCGTGGCAGTTTGTGCCACGTATCCATCCCAGTCGAAGGTTTGCAGCCAGTCGTGCTTCT
TGATTTCTATAATGCCATCAGGACCTGCACCAAGTCGCTCGGACTCCATTGGATGCAACAAGCCTCGCAGAAAGGAGCGACAGCTCTGTGACAGCTTGGC
ATTGGACCCAGACGTGCTGTCCAAAAGTTCTATCGGGTAGTACCTGTCGAATACACTCTCTGAGAACTCCTTGATGACGTCAGGGCACTTTTCGAGGTGC
GAGCGTACGCCGCCATTCCATGGCCTCCTCCCAAGCAGCAGCTCATAGGTCATCACGCCTAGACTGAAAAAATCTGACGGCGTGCCATGCTCTGTGGATC
CCCGGAAGATCTCTGGCGCCATGTACGACACGGTTCCGCTACGGCTTTGGAATCTCAAGTTCGCGGTTTGTACTGAGATGC