Description :
From Genome Similarity Track
Location :
contig_58:29314- 34432
Transcript NameFunction/comments
g10854.t1POM64006.1 Secreted RxLR effector peptide protein [Phytophthora palmivora var. palmivora
g10855.t1hypothetical protein

Sequence
5118 bases(100 bases per row)
CAAAGAGATAATCATCGTCTCTGTCTCTCTCGTCGTCTGGCACCCTCAGCATCTCGATCATCACGACGTACACAACGGTCGCTTTCCTACGGGCAGCCCC
TTCCTCATTCCCTACCAGTTCAAGCATCAACAACGTAATTTGGTCGAAGAGGTTCAGGCGGTTTCCGAGGGGCTTAATTAAGCCCGACTTTAATATCGGT
GACGTTCAAGTCGTGGAGGAGTGTTCAGCTGGACGTTTACACCACGTGGCTCACAACACCGTCATGACGACAGTCTCTTCATTTAAAGATTCACATTTCG
GATCGGTTGGGTAGAAAACAACGTACATTCCTCCGTATATGAAGTGAAGCAAACACCAGTAGGTACATGTATTGGCAATACTGAAGTATTACGTGGTCAT
TATCGGAAAATAGTATACTGCGGAGATCAAATGGCACGACAGTGCCTCAATTAACTACGGCAAGCGGGAGCGAGCGCACGAAGGCGGACCCAGCGTCAAG
CTTCACAACCAGCCCTGCATTGCTGTCGTCATCCACACTCGCGAGCGGAGCATACCGCGGGAGCGCCCAGCCAAGCTGATTATCAACGATGTCATATGGT
GTAGGTTTGGGCCATGTTATACACTTCGACCTCGCGTCATCCATTTGCACAACGCTCTTGGTAAACAATTAGTTGTCCGTGGAAAGCAATACAAATTACT
TCTCCAAGTACTCGCAAGGATGATGATGCGTCTGAGCTTCGTTGGGCTGCTAGCTGTCGCACTCCTGGCCAGTACCGATACGGCCTCAGCGCAGAAGCAA
GCGGAGGTTTTTCACCAGGATCCCCAGACCCTGTCACGTTCACTTATCGAGAGCCACGACCAACCCAGCACAAATGGATTTCACTTCACTTTCACGAAGA
CGACGACGATGAAGACAGAGCGATCCTTCCTGGCTCCGTCATTGAAAAGACCAAAGCGTTCGCTTCTCCAGCCACCACGGAGAAACTCCAGACCTGGCTA
AGCAACGGGAAATCCATCGACGACGTCTTCATTGGCTTGCAGCTTACCAAGGCTGGCGATACACTACTAGACAATCTGCAGTTCACGACGTGGCTCGTGT
ATGTGGACGATTTCACTGCCAATAATCCTGGCAAGACAACGTCAGCGATCGCTACACTCACCACTCACTACGGCGACGAAGCGGTCGCGAAGATTCTCGA
CGCTGCGAAAAAGGTAGCGGGGACGAAGGAAGTGGCCACCAAGTTGGAGACTGCGCAGATGCAGACTTGGCTGGCGAGCGGGAAAACTGCCGACCGTGTT
TTCAAACACCTGAAACTGGATAAGGCGGGGGACGGCATCCTCAGCAACCCAGCCTTCGCGTCTTGGAACACGTAGCTGAAGATTTCCAATAAGGCCCATC
CCGGTCAAAAGACAAGTACCTTCGCGAAATTGACGTGCAATACGGCGAGGTGGGTGTATCTCGGGTAGTCGAAGCTGCATTGAAGGCCACGAGTTCCTCC
GACATCGCGAAAACAGTACAAGCCGAGCAATTCGAGCGCTGGATGGCCAATGGGAAAACTACTGATAATGTTTTCAAGCTGCTGGCACTTCACAAAGCAA
GAAAGAGGCTTCTTGGGAACCCTCTTTTGAATACCTTTACCAAATACATGAACACTTACAACAAGGGGAACCCCGACCAGGAAGTCACTTTGATAGGGAC
GATAACGACTTACTACGGGGATGTACGTCTAGCCAAGTTACTTGCAGCGGGAAGGAACGTCCCGGGCACGTCGAACATCGCCACAAACTTGGATGCTGCG
CAGTACAAACTCTGGATGAGCGGGCGGAAAGACCCGGACGATATCTTTACGATGTTAGGCCTAGAGAAGGCTGGGAATGGCCTTCTTTCCAACCCGCTAT
TCACCACGTTTACAAAGTTCACGGACGCCTATCACGCCAAGCATCTTGACATCAAGATGACTACGAATTGGATTGTGAGGACCCACTATACCGATTTTGA
CGTCACTAAAATGATCCTTGCAGCGGAGAAGGTGCCAGTGCCCAGAGCGCTGGAAAACGTATGGAGGCTGTACTGTTCAAAGACTGGATGAAATCTCCGG
ATAACGCGTTCAAGGCACTCAAACTTGAACAAGTTAATCCCTCAACGCTGTTCGAACGCCCGATGTTCGCGTATTGGATGAAGTTCATGGATGATTTCCA
CAAGGCTTTCCCCGGTAACAATATCCCTCGGACCGTTCTAACGACGGCCTACAAGGACGAAGATCTGGTAAAGGTGGTCGAAATGGCGCAAACGAACCCG
AACTCGAAGGATCTTGCGAACAAGTTGGAGATAGAGATGTTCAAGCAGTTCATATTCGCAGAAAAACAACCGATCGATGTTGCCAAACTTCTACACGTTA
GTGAAAAGACCGATGCGAATTGGAAACTTTGGAAGAAGTACATGCAGGACTATCACAAGCACCACCCGGGAAAGGTCACGATCAAGTCGTCCACGTAGTT
CCGAGAGACCGTAGATTCGCGTTTCTTGTAAAGCACTTCCGTCGTGCTTTCTCTTCTCATGAACGTAACATAGCATATAATCCTTGATAACCTGGAACTT
GACGTAAGGTGTCAGGTGTCAGGTGTCAGGTATCAGCCTTAAACTACACGTGGATGTACCCAGCAACGTTGGAGGCCATAACCATAACCATACCTTGCTA
CTTATGTGCTATCATAGCTACCCTTTTCGACGGTGTGTGAGAGACCCTACTATGCAGATTCAAGTGAACAATGACTTTAGTGCGCTGTGTAATTGCCAGG
AGGTGAGGCAAGTCCTATTGTAGTTTTGCTGCACGCCTGGTGGAACAGGATTTATTGGTGTTCTTGTTTGTTCCTCTGTCCGTTGCATCTAGCTGGGAGC
CAAGAGGTTTTATGGTCAACCCGTTACCAAGGAATGTCGACCGTCCCGAACGGGTATTCGCCTGCGTTGGGCGTGGAGTTCGAGCAGAGCGAGCTGCGGA
TTGTGGTCTTGTTGTACACATCACAGTCGGTCTCAGGCTCGATGGCGACCCAGAACTCGCTGTCTCCGCATCTTCTTCAAGCGCTTGCCGATATGCGGGT
GGTACACCCCCCAGTCGTCAGCCGTGAGCGTGAACTGCACGCCCCGCGTCTCACCTACTTCCAGGCGGATTTTGGAAAACTTCTTGCGCTGCTTCATCTC
AGGCACGTTTGAGGAACAACATCACGGCCTCTTGCACGACATCGACCCGCTGTTCGTCACGTCCACGGAGACGGTGGTCGAACTATTCGGGTCCTGGATC
GTGTTCTTACTCAGGGTAGCAGTCGAGTACGTGAAGTCGGTGTAGCTCAACCCCGTACCAAAGCCCCACTGATTTTCGCAATAGAACGGAGCCCCAGTAT
GTTCTTACACATGGTTGGCACGGGGTGGTTCTACACCGTCTCAACGTTAGCGAGGTCCTTCGGGTACATGATCAGCACTAGCCGAGAGCCGCCCGAGTTG
CGGGCGGTGGGTGCATGTTTAGTTGGTGCCCGTTCGCTCGCTCTTCCAGCTCACTTCACTACTATTTTTACTATGACAGGGTTATGTTTTATTCAGTATA
TTTACTTTTGACTTGAACCACAACCCTAAGCCCGCTACGGCTCGCAAGCTTCGCCTCCGCTTGTCTACCATGCACTGCTTGGTCCTGGGTTTGCACCCGC
GTGCTTCGCACACGGGCTTCAAACCACAGGCATACTCGCTGCGCTCGAGGGGGAATGGTGACTCTCAACAATTACCGCTATGCAAAGTGACAAATGTATT
CCTTTCGTAAAATATGCATTCACACGAAGTCGCTGCCTACGCCCTCTCAAACAGCTGTCGGTACACTATGCTCGCCGTGTACACTCCGTCTTCTTCCTCC
CGCTCTGGATATTCGACCAACACCTTGAATCTCGACCTCGACATAACCCTTGACATGGCCACATACAGCTGACCGTGGGAAAAGCAAGGAGTCGCCAAGT
ACAGTCCCAGGTACTGCACCGTTTGTCCCTGCGCCTTGTTGATCGTCATGGCAAAGGCAGTCTGGATAGGAAACTGCCTGCGTCTCAGTCGAAATGGGAA
ATCGCGGATGTCGCCATCGCTGATGAACACGATGCACGGGATCAACACATGCTGGCCTTGCCTGTCGCCGGCCATGATGGTGGCATGGATGACATGATCT
TTGAGTTCGACGATTCGCAGGCGTGTTCCGTTGCACAACCCCAGGTCAGGATTTAAGTTCCGCATCATGATGATCGGCATCCCCTTCTTGAGTTTCAGCT
TGTGGGGTGGGATGCCACTGATGTTCAGGGAGTTTCCTGCTTGAATAAGTTCCCGTCCTCTTCATCCTCCACTGAGTCTGTGGACACATATTCTTGAGAT
GGCCCAGTCATACGATCCGCTACGGCTTCGTTGATACGATGGACTATCGCGTTCGTGGTGGTGAGGATGGTGCGACTCGCAAAGTACTCGTCCGATGCGA
CTTCCGAATTGTTGATGTCGGCGTACATCTCGTCGATCATGCGCCGCATACCTCGCGGAATAGCTCCCGGTCGGATCTCCTCGTCCTCATCTGGATCACC
GGCGGGGTTGTCGATGATGGAATCTTAATGTAGTCATTTCCCAGATCATTGTGTACCTCGTGTCTCTCCTCTCCAACGTTCAGCAGGTACTCAGAAAACG
CAGCCATTTCTGAAGCACTATCGGAGGTGGCAGCCGTATGTTCTTTGTCAGACGCACCTTATGGAAAAGTGGCCACCGTTCGGATGACTTCAGGCATGCG
TCGATTGTCTCTGTCGCCGAGCCGCCCTTCACCACCTGGAGAATTTGCCTGGAATCTCTCTGAAACTCGACCACGTATGGGAATGAAAAGAAACGTTGTT
GAAAGGCGGTGTATTTTGTCCAATCAGCAGTGATTTCATTCGGCTACTTCCGATGTGATGTAGTCCACTCTACGCATTATAATAGCCAATCGCGCAGAGG
CTCCACTATATAGCCAACGAGAGGCCTCATATTATAATTATAGCGAATAGGGAGGCCACCTTCGCTGCGCTCGGCAGCTATTTATAGCCAACGGAAAGTC
CGGACTTGCGTTACGGTC