Description :
From Genome Similarity Track
Location :
Scaffold_25:29313- 31790
Transcript NameFunction/comments
Phyag_g699hypothetical protein PHYSODRAFT_467172
Phyag_g700proline synthetase co-transcribed bacterial protein

Sequence
2477 bases(100 bases per row)
AACCCGTTGGGGATGTCACTGTGGCCGTTGATCTCGTAGAATCTCCGCAGTGCTGGCAGAACCAGCACCTCCCACTTGTGTTGCCGCATATCCCACGGAA
AGTCGAGTgcgtccaggtcgtccaAAGCGAAGAAtggcaacttcttcttctgctgcttgagtACGCGTAAGTTCCTGCAATGCATCCCTAGTGGATAACC
CCAAGCTTTCTCAGGCCAGTCACGAGCTCTGTAGGGCACGACGAACTTTAGAGGAACCATCAGGTGCTTCTCTAGGGTCAAAAACGTCTGCAGACTTGGA
GCGACGGTCTCGACCCAAGTGCGTGCACTCCACAAGTTGATTCGGGCGGTTCTAATgggtggagatggagaagagtCACTGGCACATCGGATGGCATTGG
ATTTATCGCCTGGAGTGACGTGTGGGCGGCGTACCAAGCTGCCGCGTCGGGACAGGAATGCGCGCAGCATTGTCTGTGGTGTACTGATGGTGGTCACTGG
CTAATCCCAGTTACGGCACAGAAATGTAGCTAATGGTACATAATAGTGTGTAATGCATGTATAACGTGGTGTGGTAGACATaaaggcaagttgaagtgga
gttCGTTGCATCGACTATTTTTGAATAATGGGACTCCGCTCCTTTCGTTTCAACGGGACTGGCGTAAATAATTGGCCATTCTCACACTTGCTCAGCAACT
CACTAGCACATACAAGTCCGTCACCATGATGACCGAAAGTAACAACCTGCTGTACCATCCGAACGATGGCGGATTCGATCGACTGGAGGAAATGGAAGGC
GGGGCGCTGACGAGATATCCAGTACTTCGGTCGGTCCCGGTGCCGTTGACACGTCGGTGGAGCACACGTGGGGCGATAGCGCTGCTCATGGTGTGTGGAG
TCATCCTCGGGGTCATTGCGGTCATGACGTTAAGCGGGTCGAAGGGGTCAAGCGAGACCGCAACTACAGAAACGTCAGCTGACGCGAATACTGAAGAGCT
GTCGTTCCTTAGTGGGTCGGATAGTCTTGCAGCCGGAACTGTGGAGACCGAATCGTCGTGGGTTGGACGCGCAAGCGCTGATTCATCGGCACAGCATGAG
GCGGCCGGCTCAGTAGATGACACTTTAGCCGGCTCAACAACCATCTCAAGTGCTGCGTCAAAAGACTCGCACGCAAAAGATTCGGCAAGCGGCTCGGATG
GCAGCACATCCGCTTCATCTAACGAAGAAGTTGTAGGTAATCTGCTTGAAATTCGGGATGACGACTCGCAACGCGGATCTCTGTCCATCTCGGCTGTAGG
TACTACCGATTCACAGAGCGCTTCAGTGGACAACGTAAGGGAGATTTCAGGCTCTGATTCTACAGATGCATCAGCAGGCTGGCTCACCGACTTCAGCGAT
GATAGTGATTCTGCTGCCGACTGGAAACTGAGTTCATCTTCGATGAGCGCGGAGACCAGCGATTCGCAATCTCGCTCGGACGATGGCTCTTTGGAGTTTT
AGACGTGGTCACTTAGAAGTAGGATCGCCACAAGTTAGCTTAACTTCCGCGCTCTCACGTTATGGGTCCCGCTTTTGAAAATGTTTTTCGATTTGAGTCC
CGCTTTACCATTTTTGTATTTTTGCCCCATTTTCGTATTTTAGTAGAAGATGGCTGTTGCCAAGAACTTGCTGGCCGTGCGTGCAAAGGTGGCGGAGGCT
GTGGCCAAAAGCGCTTGGAAACAGCCGTGCACGCTGGTAGCTGTAAGCAAGACCAAACCTATTGAGGACCTCCAGGAGGCTTACGATGCGGACCAGCGCC
ACTTCGGCGAAAACTACGTGCGTGCCATATTTTGCAGCCATTTACAGTTTTATTTGTGGCACTAATCCATGTATTTATGGCAAACAGATTCAGGAATTGG
TACAGAAGGCACCACTGCTACCGGCCGACGTCAAGTGGCACTACATTGGTCACGTGCAGTCCAACAAGGCCAAGCCGCTCGTGCGTGACGTGCCCAACCT
CTTCGTAGTGGAAACGGTGGACTCCATCAAGATCGCCAATGCTCTTAATAAGGCATCGGGCGAGTTCCGCACCGAAAAACTCAACGTGATGGTGCAGGTG
AACACCagtgaggaagagcagaagtCAGGCATCGATGGCGACGGTTTGGTCGAGCTGGCCCGCCACATTGTGGCGTCCTGTGAGCACTTGAACCTCTCGG
GGCTTATGACCATCGGCCGCTACGGTGACACAACGTCCGAGTGCTTCGATCGTCTGGTGGCCTGCCGCAAGCTTGTGGCTGAGGCGATCGGAACGGCTGA
GACGGACCTGGCCCTCAGTATGGGCATGTCGGGGGACTTTGAGCTAGCGGTAAgacttggtggtggaagtggtggtgtCATAGCGTGCTAATGTTTTTTG
TCTTGTTAGATTTCATCCGGAAGCACGCATGTCCGCGTCGGGTCGACCATCTTTGGAGCTCGTAACTACGCTAACAA