Description :
From Genome Similarity Track
Location :
Scaffold_60:29309- 31678
Sequence
2369 bases(100 bases per row)
GGCAGACGCAGATGGAGTAATCCATTTACGAAGAACGGCGCGTACGTCGTCGAAGCGTGTACTTACTTGTTGATGGAAAATTTCACCATCGGCAAGAACT
CGCTCCAATTCGCAAAAGAATGGACGTACCCACGAAGGATCTCTTCGATGAAACGATCGGCGCGTTCGGTCTGATAATTTGTTTTAGGGTGGTCAGATTC
GGACATATTTAAGCGCGTTCCGAGTGTTTTGATAACAGAACGCCAGAGTTTAGCTGTGAATCGCGGGTCCCGATAGGACACGAGTGCAAGAGGCATCACA
TGAAGGCGAAAGACCGTGTTGATAAAGACACGATCACAAGCCGATGCGTTGATGGGTTCAAGTACAGCAACTAGATAACCATCTTGCTAAAACTGTCAAC
GAATACAAGCATACCAGTATTATTATGTGGGTCTGCGGGGCATCCGAAGACGAAGTTCATTGAGACGGATTCCCAGCACTCTGCCGGGATGGGCAGACGA
TGCAAAAGGTCACGAAGGGAAGGACTAGACTTTTCCCGTTGACAGACCTCACAGGCCCCAATGTACTTGCGCACAGAATGATACTGGCGGGGCCAGTAAA
AGTCGCGGCGCACTGTGAAATATGTTTTCTCACGACCACGATGTACACCAACAGGTCTGTCGTGGTACCCAGGCATGATGCGCAATCGCAGATCACCCTG
ATTTGGTACGACGAAACGAGGATTGTCGCTGGCAACAGACGAATAGTGGAGTAAGCCGTTACGAACTGCATATCTATCCTTAGAGGATCGATATACTGAC
GACAACTGTTTAGGGCTCTTCCTGGATGAGTGCGAGAGATGTTGAATCAATCGCACTATCTCCAGATCATACGCCCTATGTATGTCTTCCAATAAGGTTG
AAGACGGGACACTCAAAGTCAATACCGCAACAGTGGTCGGACCAGTCTCGGGTGGCACAGCCGGTTCGATATCGGGCCGTCACGAGAGTGCGTTGGCGAA
CACATTACGTAGTCCTGGCTTATATTCGACAGAGAAGTTATACTCAGAGAAGAATGACAGCCACCTCGCTATCCGCTGCGCGAGGTGTGGAATATTTACG
GTAGTGCGTAAAGACGCATGGTCGATATAGACGATAAACCGGGTCTCTATCGCTTAGCAGATAGACTCTAACGCTTTGCCAACGCGTACTTCATGGCAAG
GCGTTCCTTGTCATGGACGAGTTAGTTTCTTTCTGCTGGTTGCAGCTGGCGTGACTGATATCTGACGACACGTTCCGCATCGTCTGTAACTTGGTGCATC
AATGCACAGCCGATTGAAAAATCACTGGCATCACAAAACACATGAAATGGCCTGTCTTGGTTTGCAATTGCCAAAACCGGTGATCGTATCAAGCTTTTCT
TGATACCTTTGAAGAGGCGCTGACAATCACACATACCCACTTCTCGTTCTTTTCTAATAAACGAGAGAGGTGAACAGTCATCATGGCGTAATTGTACGAA
TATTTTTGCGAATACGCCGCAAGGCCAAGGAACTTCCAAATTCCCTTAAAATCTGTAGGCACCGGCCAGTCTATGATCGCTTTGATCTTTTTTGGATCCG
GCTGAACGCCATGCTTACTCACGATGCAACCAAGTACGGGTATCTCGCTAGCAGCAAATGTACACTTCTTGAGGTTGGCGTACAATTCATCCTCGCGCAT
AAGTGTAAGAACTTTCCGGACGTGAAGTCGATGCATTTCCACTTCCGTCTGTCCATCCATATCCCGGCTATGGACGTGCAGATCATCGAAGTAGCTGGGC
GCAAATTCTCGTACAGACTTCAACAGATCTGTCACACATCTGTTGAATGTGGCAGGGGCGTTATTTAGCCCTCGTGGCATTACTAAATAATCCCAAAGCA
TATCGCTTGGGGTGCTCACTACAGTATAGGGAATGTCCCTTTCGCGCATTAGGATCTAATAGAATTCGTCCATTAGATCCATTGATGAAAATATGGTTCT
CTTTACCATACCATCGATACTAACATATTTCCTTGGTATTGGCGTTTGGGCCGATACAGTGGCAGTATTCAACTTTTTGAAGTCATGTACTATCCGCCAT
CCACCTGTGGCCTTTCGGACACAAAAGGTCGGAGAGATATGTGGGAAAGTAGATTCCCTCATATGGCCTGCTGCCAAACGATCGGCTAAGAATTTGTCGA
CCGCTAGTACTTGTGCACGAGGCAGTCGCCAGTGCTTCATGACACAGTACTTCGAACCCGGTCTCAGGTCAATTTCATGACGAGTACTTTTGTCCTTATT
TAACTCGTACGGCACTGCTTCTGGGAACACATCTGTGAATTCCGTCAAATCATGGTAGAGAGGATTTGA