Description :
From Genome Similarity Track
Location :
contig_58:29307- 32240
Transcript NameFunction/comments
g8829.t1hypothetical protein

Sequence
2933 bases(100 bases per row)
AACGGTCGCTTTCCTACGGGCAGCCCCTTCCTCATTCCCTACCAGTTCAAGCATCAACAACGTAATTTGGTCGAAGAGGTTCAGGCGGTTTCCGAGGGCT
TAATTAAGCCCGACTTTAATATCGGTGACGTTCAAGTCGTGGAGGAGTGTTCAGCTGGACGTTTACACCACGTGGCTCACAACACCGTCATGACGACAGT
CTCTTCATTTAAAGATTCACATTTCGGATCGGTTGGGTAGAAAACAACGTACATTCCTCCGTATATGAAGTGAAGCAAACACCAGTAGGTACATGTATTG
GCAATACTGAAGTATTACGTGGTCATTATCGGAAAATAGTATACTGCGGAGATCAAATGGCACGACAGTGCCTCAATTAACTACGGCAAGCGGGAGCGAG
CGCACGAAGGCGGACCCAGCGTCAAGCTTCACAACCAGCCCTGCATTGCTGTCGTCATCCACACTCGCGAGCGGAGCATACCGCGGGAGCGCCCAGCCAA
GCTGATTATCAACGATGTCATATGGTGTAGGTTTGGGCCATGTTATACACTTCGACCTCGCGTCATCCATTTGCACAACGCTCTTGGTAAACAATTAGTT
GTCCGTGGAAAGCAATACAAATTACTTCTCCAAGTACTCGCAAGGATGATGATGCGTCTGAGCTTCGTTGGGCTGCTAGCTGTCGCACTCCTGGCCAGTA
CCGATACGGCCTCAGCGCAGAAGCAAGCGGAGGTTTTTCACCAGGATCCCCAGACCCTGTCACGTTCACTTATCGAGAGCCACGACCAACCCAGCACAAA
TGGATTTCACTTCACTTTCACGAAGACGACGACGATGAAGACAGAGCGATCCTTCCTGGCTCCGTCATTGAAAAGACCAAAGCGTTCGCTTCTCCAGCCA
CCACGGAGAAACTCCAGACCTGGCTAAGCAACGGGAAATCCATCGACGACGTCTTCATTGGCTTGCAGCTTACCAAGGCTGGCGATACACTACTAGACAA
TCTGCAGTTCACGACGTGGCTCGTGTATGTGGACGATTTCACTGCCAATAATCCTGGCAAGACAACGTCAGCGATCGCTACACTCACCACTCACTACGGC
GACGAAGCGGTCGCGAAGATTCTCGACGCTGCGAAAAAGGTAGCGGGGACGAAGGAAGTGGCCACCAAGTTGGAGACTGCGCAGATGCAGACTTGGCTGG
CGAGCGGGAAAACTGCCGACCGTGTTTTCAAACTCCTGAAACTGGATAAGGCGGGGGACGGCATCCTCAGCAACCCAGCCTTCGCGTCTTGGAACACGTA
GCTGAAGATTTCCAATAAGGCCCATCCCGGTCAAAAGACAAGTACCTTCGCGAAATTGACGTGCAATACGGCGAGGTGGGTGTATCTCGGGTAGTCGAAG
CTGCATTGAAGGCCACGAGTTCCTCCGACATCGCGAAAACAGTACAAGCCGAGCAATTCGAGCGCTGGATGGCCAATGGGAAAACTACTGATAATGTTTT
CAAGCTGCTGGCACTTCACAAAGCAAGAAAGAGGCTTCTTGGGAACCCTCTTTTGAATACCTTTACCAAATACATGAACACTTACAACAAGGGGAACCCC
GACCAGGAAGTCACTTTGATAGGGACGATAACGACTTACTACGGGGATGTACGTCTAGCCAAGTTACTTGCAGCGGGAAGGAACGTCCCGGGCACGTCGA
ACATCGCCACAAACTTGGATGCTGCGCAGTACAAACTCTGGATGAGCGGGCGGAAAGACCCGGACGATATCTTTACGATGTTAGGCCTAGAGAAGGCTGG
GAATGGCCTTCTTTCCAACCCGCTATTCACCACGTTTACAAAGTTCACGGACGCCTATCACGCCAAGCATCTTGACATCAAGATGACTACGAATTGGATT
GTGAGGACCCACTATACCGATTTTGACGTCACTAAAATGATCCTTGCAGCGGAGAAGGTGCCAGTGCCCAGAGCGCTGGAAAACGTATGGAGGCTGTACT
GTTCAAAGACTGGATGAAATCTCCGGATAACGCGTTCAAGGCACTCAAACTTGAACAAGTTAATCCCTCAACGCTGTTCGAACGCCCGATGTTCGCGTAT
TGGATGAAGTTCATGGATGATTTCCACAAGGCTTTCCCGGTAACAATATCCCTCGGACCGTTCTAACGACGGCCTACAAGGACGAAGATCTGGTAAAGGT
GGTCGAAATGGCGCAAACGAACCCGAACTCGAAGGATCTTGCGAACAAGTTGGAGATAGAGATGTTCAAGCAGTTCATATTCGCAGAAAAACAACCGATC
GATGTTGCCAAACTTCTACACGTTAGTGAAAAGACCGATGCGAATTGGAAACTTTGGAAGAAGTACATGCAGGACTATCACAAGCACCACCCGGGAAAGG
TCACGATCAAGTCGTCCACGTAGTTCCGAGAGACCGTAGATTCGCGTTTCTTGTAAAGCACTTCCGTCGTGCTTTCTCTTCTCATGAACGTAACATAGCA
TATAATCCTTGATAACCTGGAACTTGACGTAAGGTGTCAGGTGTCAGGTGTCAGGTATCAGCCTTAAACTACACGTGGATGTACCCAGCAACGTTGGAGG
CCATAACCATAACCATACCTTGCTACTTATGTGCTATCATAGCTACCCTTTTCGACGGTGTGTGAGAGACCCTACTATGCAGATTCAAGTGAACAATGAC
TTTAGTGCGCTGTGTAATTGCCAGGAGGTGAGGCAAGTCCTATTGTAGTTTTGCTGCACGCCTGGTGGAACAGGATTTATTGGTGTTCTTGTTTGTTCCT
CTGTCCGTTGCATCTAGCTGGGAGCCAAGAGGTTTTATGGTCAACCCGTTACCAAGGAATGTCGACCGTCCCGAACGGGTATTCGCCTGCGTTGGGCGTG
GAGTTCGAGCAGAGCGAGCTGCGGATTGTGGTC