Description :
From Genome Similarity Track
Location :
Scaffold_105:29307- 31071
Sequence
1764 bases(100 bases per row)
ACATTTCCCGAGAACAAATTGACCCACAGAAACAACTCGGTGTTTTCCTTAAAGGATCTTGGCAACGAAGGGATGTGATCCATAGCTATAATCTGAAAAG
GGTACGTCGATTGAATATTACCAGGTGATCCACTTCGATCCCCCGGCCGTCCTTTTCCCGTTTCACAATCTACACACTCTCCCTCATACCACTGCAAACT
TCGGTACAACCCACGCCAATGGAAATTCGCCCTGATCCGTTGATAGGTACGGCCGATTCCTTGGTGATCACCCTCCAAACTTGTGTGGTAGTGGTGCAAG
AAGTCTCGCTGTAACTGTTCTGGAACCACCAAACGAGCCAGTTCAGTACGATCTTCAGTTTCGGTGGCCGATCTCGGACAGAAGAATAGCAGCCCACTTT
GGTCTACTTCATAGTCCGGTGCGATCAGGATGCACACCTTAGCTTCAGCTGCCGATAATTTAGCTACGTCTCCAACCAGATATATCTTCAAATTAGATAT
CCAGTTTTCTTCGTCTTGTGCCTGCTTAATACGACCAAATCCGTATCTGCTGCACAACCTCTTCCTGTAAAATCCAGGGCTGACAACGTCTTCTCTGGGC
TGTTCGAGTGATAGCCGCTACTTTGACCGCACGATCAACTCGTTCTGGTAGTAGTAATTCGTTTAACCAATTGAGAGTAATCAGGTCCTGACGCTCTTGA
TCGGAAACCACAACTGTCCCTTTCTCTTGCCGTAGAGCTTCACTCGCCAATCGATCTGCACTCTGATTCCAGTCCCTCTTCATGTGCAAGAACTCGTGGG
ATGGTCACGATCGTAATCTCTCCATAGCTCTATGCCCCAGCAACTGCAGTCCCAGCGCTTTACAGTCGATTTCTCCTCGCATTTGACGGATCACCAAATT
CGAATCTCCGCAGATAATCACCCGTCCCCTTGCCTGATCGGCAAGCAAATCGAAACTAAGGAGCAACCCTCGGTATTCTGCTTCATTCACGGTTTTATCA
GGGGTATACTCGGAAGCAACATCCACAATCGTCCATTCCGGCAGTTTCCATATAATTGCGCTGTATGCTCCGCCCTTTCTTTTCACCCTAGTTGATCCAT
CGAAACTGGCTACCAGCAGGTTTTCATTTACACCTACTGTGGGTGGTGGCATGCTTCTCGTCTGTCTTGGTTGCTTTCGCGGGGCGATCGCAATCAAAAC
TTCATCTACTTCTTCACGAGGTGTTATACTTGCCGCAAGCATCCCGAGTATCTCATCTTCTCCCTTTTCAGATCGCCTAATTTCCAACGTCCAGTTCGAT
AGTAAAGTAGCCCATCTTCCCAATCTTCCGTTGAGGCCTGAAGATTATAATAACCATGCTAGTGTCGAACATCGCGTAAGCACCGTAATCTCACGGGATA
CTAGCATGATAGCAGATATCTAGCATTCAGAGGAGAGCCAACACTTCTTTCTCCACCATCCCGTAGTTGACCTCGTTGGGCTTTAGCGTACGACTGGAGA
AAGTGACAGGCCAATACACACCATCATATTCTTGAAGCAGAGCAGCTGATACAGCCCACTTACTAGCATACACCACGATCACAGGCGATCGATCGGGATC
GAAATGCTTTAAGTAGTTGGAATAAATTATAACATTTAAGACAATTTGATTATATTGGCAGCATTTTCTGTGTTGCGCAAGCTTATCTGAAAAAAATCGG
TATGATTCATTCCACGGGCACAGCAAAGGTTACACAAAGAACTGTAGTTGCCCTAATATTGTAT