Description :
From Genome Similarity Track
Location :
Scaffold_7:293063- 295185
Transcript NameFunction/comments
Physo_111765predicted protein

Sequence
2122 bases(100 bases per row)
GGAGCCAAGAAGGAGGACAAGAAGGCGGCGGAGGTGGACGAGCTGGACTTTTTCGGCTTCGATGCGGTCCAGAAGCCCAAGGAGAAGGCGCCCAAGCCGC
GCAAGATCAGCGTCGACATGGTGCCCGAGTGGGCCGGCAACGAGCCTGCCAGCAAGCCGCGCAGTGGAGAGGGCAGCAAGCTTCGCCGCAAGCGCAAGCT
GAGCGCTGGCGCGTTGGAGGAGCTGCGCATGGAGGAAGAGGCTCGGCAGCAGGCGTCGAAGCTGCTGGCACCCCCGAAGACCAAGGCTGACAAGCGCAGG
GAGAAGCGAGCGCGTCGTCGCTCACGCACCGAGTCCATGGGCAGCGAGGCTGCGTCGCAGAAGTCGGAAGTGGACGCTGAGTCCGAGTCCGGAGACAGCG
AGGAGGAGGACGAAGATGAAGACGAAGACGAGGAGGATGCTGTGACTCTGTTCAAGTCAAATGGCGAAGATGCGGACGAGGACATGGCCGATGCTAGTGC
TTCGAAGAAGGCCAAGAAGGAAGCCAAGAAAGCGGAGAAGAAGAGCACTGCTACCGCTGAGCAGTAAGTGGGTATGCTTGTGTGGATGCTGAAGTGACCG
AGTACTAATGATCGTTTTACGTGTATCAGAGAGGGAGTTCAGATGCTTCGACGCCAGCTTGGTATCCGTGTGAGCGGCGTCAGCGTGCCTGCGCCGATCA
CTGCGTTCGCTGACATGCGCATGGATTCGAGTGCAAACGCGCAGCAGATGAAGCGCTTGCTGTTGAAGAACATCGGGCGCTCGGAGTACAAGGAGCCAAC
GTCGGTGCAGATGCAAGCCATTCCCAGCTTTCTGCTGCGGCGTGATGTGCTGGCCACAGCACCCACGGGTTCCGGTAAAACTGCAGCGTTTGCCATTCCT
ATTCTCGCGAACTTGGCAGCTGGTAGTGGAACTGGCAGCGGGATTCGCTCGATCGTCCTCGCTCCGACTCGTGACCTGGCTGTGCAGATTCGCTCTGAGT
TTACGCGCCTTGCGGCTGGCAAGAAGCTGCATATCACGCTGCTTTCCAAGGCTACCGCTGCGACGATTGCTTCCCAGACCAAGAGCAAGATGGCAGTCAA
CCACGACGTTGTGATCGCAACACCGCTGCGTCTCGTGCATTTGATCCAGGAAGTGAAGGTCGATCTTTCGACTGTTGAAATGGTGTGTCTTGATGAAGCC
GACAGACTACTGGAGTTGGGCTTCGTGGAGCAGGTGGACGAAATTTTTGCTGCTTGCACTCACGCCAAGGTCCAGCGGGCCATGTTTAGTGCCACGATGC
TGGAAGGAGTGGAAGAACTGGCCCAGACTGTGCTGCGCGACCCTGTCAAGGTGGCTGTGGGCACGAAAAACGCTGGTGCCAGCACGATTGACCAGAAACT
TGTCTTCGTGGGCAAGGAGGAAGGAAAGCTTGTGGCTATGAAGCAGCTGCTGCACGACGGACTTCAGCTCCCCGCGCTGCTCTTCGTGCAGAACAAGGAG
CGTGCTAACGAACTCTACCACGAGTTGTTGTACGATGGAGTGAACATCGGCGCCGTCCATGCAGACCGTACCAAGGAGCAGCGTGACGACGTGATTCGAC
GTTTCCGCACGGGTGAAGTCTGGGTGCTCATTTGTACCGACCTCATGAGTCGTGGTATGGACTTCAAGGCCGTCAACATGGTCATCAATTACGACTTCCC
GCAGAGCGCTGTGAGCTACATTCACCGCATTGGTCGCACAGGACGAAATGGCCGCAAGGGCAAGGCTGTCACGTTCTTCACGGAGGACGATATGGTGTAC
CTGCGTACAATCGCTAACGTGATGAAGATCTCTGGCTGCGAGGTTCCCGACTGGATGCTCTCGCTCAAGAAGGCTAGGTACGCTGGCACTGACCATCACG
GATCTCGTCATTTCATTTTGCTAACTTGTGCTTCCTTTTGTGTCCCATTACAGTATGTCGAAGAGGAAGGAGCTGCTGAAGGCGCCTCCTATGCGCCACC
GTATTAACACTGTGTCGGGATACGATCTCCAAAAGGCAAACCGTCTCAAGCAGATGAAGCAGGCGAAACACAAAAAGAGCGGTGGTGAATCCAACCAGAG
CAAGTCACAGTCCGACAAGAAG