Description :
From Genome Similarity Track
Location :
scaffold_209:29304- 30433
Transcript NameFunction/comments
Pl_107676glutathione S-transferase, putative
Pl_107677hypothetical protein PHYSODRAFT_466681

Sequence
1129 bases(100 bases per row)
AGACTTGGCCATTTACGCGTTGGTTCTCCTTCTGAAAGCTGGTAGACCCGGTATCCCAACAAGCATCACTGACCCGTACAAGAACTTGCTGTGTGTCTTC
AAGCAGGTGGAAGCGCACTCGAAGGTTGTCGAATGGTACGTTGCTCACGATTGAATTGGGATAAGCAAGTTGGGCAAGTTGAAAATGCATCCAGTAGCAT
CCACAGACGATTCATGCATATGACAGTCTTTATGCTAAAAGCAACATGCAGTCAATCTTCCAAAACCGAGTTCCCCTCCGTTGCTTGTCTATTCATGTTA
AGGGTTAATCAACTGTATCGCCTTCACTCTGATGAAGCTTTCAAAAACAATCACTACTACGGTGCAGATGCAGTCTTCATTGTGGTGAACACTCTTCTCA
AAGTTGGAAGGGTTCCTGGCTGCAACCACAGGCCCATTTCAATACCTTACAAAACGTCTTCGAATGGAACGCAGCATAAATACTGCTTACATTTAGGCAC
ACGTCATGCTGTACACGCAAGGTGCTTGTGAACAAACAATAAATTCACATACGTGAATCACATTAGCCATTTGTAGAAAACTCGAAAAGATTTGCTGTTC
ATACGAACAAGTATTATTTTCCGCCGCTAGAGATGCGCAGCACCAGAACCATCCGTCTTATCGCCGTCGAGGGTCTAAACCCTGTGCATCTGGCACTCTG
CGTTGGTAATGTGAACTTCGAAGACAAAGCACTAGCTTCTACAGACGCTGCACAACGTCAACAAGAATTGCAGGTTGATGGCGACTCGTTCACTCATCCT
GAAGCCATGCTTCGCTGTGCTGGACGCTTGAGTGGCTCGTACCCAGTCACTTCCCCCATCATGGCACTCCAAATCGACGAAATAATTCACGCCCTTAGTG
AGGTACAAGCCAAAATGAACTACCCAGAACTCGAGGCGTCTACGATCTCACACTATGCTTCATTAATCGAGGCGCGCCTGCAGCGTCTGCGACACATTCC
GGTATCCGAGTTTTACGATGACAATGTCCTAGTTCACGAGATAGCATTGTACTGTTGGACAAAGTCCCTTCGCGATCGCAGACTCGATGGGATAATTGAC
ACGCACAAATGCATCGTCGAAGTGGAGGC