Description :
From Genome Similarity Track
Location :
Scaffold_11:293030- 295722
Transcript NameFunction/comments
Phyin_T30-4PITG_07383Acyltransferase family
Phyin_T30-4PITG_07384Isoamyl acetate-hydrolyzing esterase 1
Phyin_T30-4PITG_07385Major Facilitator Superfamily (MFS)

Sequence
2692 bases(100 bases per row)
ACACTCCACTCAAACATCGTCGACAGGCAGGACGGACGCAGCAATTCAATCACAAAGATCGTCGTCAACAGCGCGCTTACAAACGGGAAACCTTTCGCCA
CCGGCACAGGATTCGGCTCGACCCAATCAAAGAACAGTCCTTTGAAGCAGACGCTTAACAACACGGCAATCGTCAGACTTTCCACAATTCGAAGCGTCAA
CGTATGCCACCAGCGAAACTGGAACCCTGTGTTCTTGATCCATGAGTCCAGCTTTACGAACACGACAGCAGCCAGCGAACCCGATATGAATGTTGGAATG
TGCGGCTCTAACGGAGTGTGGCTCGTGCGGTACTCGTTGACGCCCTGGCGTACAACCCACATAGCCATCGGAGCCACAGCAAGCCACCAATAGCGACGCA
TACCCAGGATAGCCAACACGAACACGGGAATGACGAAATAGTACGAGATTTCCAGTGGTAGAGTCCAGAGCACGAACTGCCGATGGTTGAACTCGAACGT
AAGCACCTGATACAGATCAAAGTCACCGGGGTTCTTGAAGAGGAAGTAGCGGTTCTGATCTTCTGCGGACATGAACGAGATCGCTATCACAGTTATTGCG
AAAAGTGGATACACGCGGAAGAATCGCTTTGAGAAATAGTCCACCAACGCGAAGATCCACGTTCGAATGCCTGCGCCTTGAGCCATCAACTTCATGCTCT
TTTTCATGAAAAGCCACGTCAATAGGAAGGAGGACAACACGAAGAACGCGTCCACAGCCACTGCGCCAAGATTAAAGCCTTGCATATACTCTTTCGAGTG
CTGGGCGACGACCAGGATAGCTGCGAGTCCACGCACGCCATCAAGGAATAGAACTTTCGTCGGTGGGGCATGTAAAGGCTTGGACTCTGGAAGCTTTTCC
ATCGAAGACTTGGTACTGGCATCGGCGTGCTCTAGAAATGTCTGGTGCTCCGAATTGGACGAAGACGTCGAGGTCTCTTCGTCCGAGGCCTCGAGCACTC
GCACCTGAATGTCGGTCTCTCTGAGGTTCAAGTCTTCCGCTGTAAGAGAGCCATTTCGCGTGCTCTTCAGCATCCTGTCTTGCGTCGTTGGGGCTTGACT
GTTAGGATCTGACAATGATCAGCAGATCGCTGCGACGCGATTTTCATGGTGCCAAGCCAGACTCAACAGCATCCGCAGGAACAGTAAAAATTTACATGGG
AAAAACAACAGTTGGGATAGATTAACAAGATCTGGAAAATTAGTCGCGGGATTCCCGTGAATAGTAGCGTCCACACAATTATATGTACCGGCAAAGGGGA
TAATCATTGCACTGAAGAAAGTGTTCTTTGGCTGTGCAACCTGCCTCGTCACTACATTCGGCTCAATTTCGCAGCGAAAGTTCGTATTATAATAATCGTT
TCCCAAGAACAAGCACGAAAAAGGCACGAATTTGTGTCACCAAAACGGAGTTGGCGCTATATTATGTCACTGGGCTTTAGCCATTGCGGAACATCTCTCT
GTGTAATGTCAAGCCGTTTCCTCGCATTCCTGCGCGCCATCCTGGTGGGGCACCAAGTCGTGCCAATCTGGTAGTTGCCACTTGTTGAATCTGTCGAGAT
CTTCCTTGTCAAACATTCCGTTGATGGCCACACCCAGTAATTTGCCGACTTCTTTGTTGCCCTTCTCGGAGAAATGCAGGCCGTCCACAAAGTAGGCTTT
ACGGACGTTTTCGTCCGGGAACGTCGTGTTGAAGTACGTGTGCAAGTCCAGCACATGGACGTTCTCGGCTGCGGCCAATTCGACGCACACTTTGGCATAT
TTCCCAGCGGAAGCGTTGGAGCGATCTCCGTGGTGCAGCGAGTCAATGATACACGGTGGAGTGATCAGTAGTACCTGCCCATGCGGGGCCAGTAGCGGCC
GTACGATGTGAAGGGTCTTCTGGAGATTAGCTCGGTAGTCCTTTAGCGATACAAACTGTGCTTTGGAGGGTCCGTGCTCAAGTACAGCGTCGTTGGCGCC
CAGGAAGATCGTGACGAAGGACGCCGAGTACTCGGACTGCAGCTCCTTGGAGTATATTGGCATAGCCTGCTCCAGCACCCACCTGGCGGACAGAATTAGT
ATGACTTTGATAAATATGGACAGCAACGTATGACACGCACTTGGTGTTGTAGCCCGAGAGCCCTCGGTTAACACAGTCAACAGAGCGAACGTAGTGGTTC
TGCAAGATCGTGATGAAGCCGGACTTGCCCGGATCGCTGCCGTGCTCGGTGATGGAGTCACCAATGAAGTAGAAGACCGGGCGGCGGTCGCAGGACAGCG
TGAGACCCATGGCGATGGCGATCTGTACACTGATACTTCAAGTAGGGATTGTGCAGATTAACTTTTACTAAGAATACCGGTACGGTGAACCGAGCCGGTA
GAATTACTGAAGCAATTTCAGCCAATTATATCTTTTAAACGGTTTCACTGGCTGAAACAAAAGACCCCGCACATGTCACATTTTTTTTAGAACTGAGCCG
ATACGCTCGAGATGAGTGTACCGATCTCTCACTCTCCAAGCCGCCGCCGACCTCTCTAGTCATTTCGTTTGTTCACTATGGGACTCTGGTCCAATGAAGG
CGTCACGCATAATGTGTGGACGGCCTACATCTTCACGCTCTTCTTCTGGTCTGCTCGAAGGTTCGTCTCAACTGTATCAAGTGTGTCAATTC