Description :
From Genome Similarity Track
Location :
Scaffold_1766:2930- 7014
Transcript NameFunction/comments
Phypl_g14106hypothetical protein

Sequence
4084 bases(100 bases per row)
TGAGCCTCCATCGCTTCATCTCTCGCGTGACCAGGCTCATGCATCATCAGCCGATACTGCTCAATCGTCAAGCGCTCCGATACGCCGGTCGCCGCGGCAG
CCGCAACCGGTCCAGTACCGTCGTGATGGCCCACCTCCACTCGTTGACACATCGGGTGCGCTGCGCTGGattgtggagctgcttgtTGACCAGGATATGC
GCGTGAATCGCGAGGCACCTCCTCGCGATACGACTGGTAGCGTCCCTGCGCGTGCGCATCGTCGACAGGCGCCTGAGAAGCATTGCCGGGTGCGCTGGCT
TGGACACTCGCCGGCCGATGATACATGGGAGCAGCGTAGCCGACTCCTTGAGGATGTTTCCGATGTCGTGAGCGACTACGAGATCTCGCTCGCGGTCACC
TCCGCGAGCGATCGCGATGTCTCCCGCCACGTTCCTGGCTGTGTGGACGACCTCGCGAGCGActtctcgagcgactgcgtcgACGATCTCCGCCTCGCGA
ATCGCGGCGCGCACTGCCGCGACAAGCCGGCTCGGCAAGATCACTCCGACCTCGATCGAAGCGCCCAATCCACCGACGTTTGTCCTCGCCCACCTGCCAG
CGCGTCAACTGGTGCTCCCATTCCACCCGCGTCGGTCTGGGTTGGCCGTCTCCATAGTTTCGGCAGCCCTCGATCATGTGCACGTAGCACAGCCGCCGCT
CGCGCTGTGCCAACTCACANAAAGCGTCGTGTGTGAACGCGTGGCTGGTTGCCTTCCCCCGGATCGCGCGGTACCACCTGAAGTAATCCTTCATGGCGTC
GAGGTTTTCGTCCTCCATGACGAAGTACGCCGACGAACTGGAGGGTACGGCGCCAGTTCCCCTTGTCGTCGGCATCGTGGATTGCGGAATGAGCGCGTGG
CGGAAACACAACGTGAGGTCGTGCTTGGTCACTTTCTCTCTGCGACGACACCCACGCGGGCGTGAGTGCAGCTTTGAGAGGAGGGTGATGtaacgggctg
tttgaagttacatatgtaggtagatctatatagctaAAGATACAAGGTAGGTACAAAGCACACGGCTAGCCGTGTGCTTCGTGTAGCCCTGTCATTGGTT
GAAAGTGGGGATCCATTTCAACTAATCAGACGACAGtttgcatttgagtggcccCGACGATCGCTAACATAAATCATCAGGCCACTTTAATAGCGGGAAT
TTGGCCCGGATTCCCGCTCTTTACCTTTTTAAAAAATGCCATTTGACATTCTATAAGTGGTATATGACAAAGCTATTCTTACTAATAAGTAGTAAAACCA
GATGCTGCGGGGGAAGCCAATGAGTTGCTCCCTACGTACCAGAACGTGCTCCCCGTGCTTGGGTTCAATGTTACCGTGTGGAAGGTAaacgggggggggg
aggCGGCAGAGGAAATTTCAGGTGCAGGTGAAGACCCGCTGGCCAAGTGATAAGAGCTGCACGCACGATTCAGCAACCGGTTTGAGATTGGCCTTGACAT
CGCAATCGTGTACGTGCAGTTCGGAGAGAGGACGACATGCGTTAAGCTATAGTTCTGTGTCATGGTAACCACGACTCTCTCTGTCGTTCTACTTGCGCAC
TTACGCCAGCTAGGACGAAAGCATACGTTGTGCTTTGATTTAGATCACACATGATAACTTGATTCTTTAGGGGTTCAAGTGCCAAACATTTACGAGGAGA
CTAGCTAGCAAGAGGCATTCACTTTGAATTCGTTCTCAATTTTATCTTCCAAGGCTCAAGTTGAGTCTCACACGTATAAACGTGACATTCTGTGTTCTGG
TGCAATAACCGGTCTTGACAATCTAGTTCGTGGATAATACTCGACGCTGGCAAGAACTTTGCGGGACTTTAGCAACCGTGTTCCCAAATACCGCGACAGT
GGAGTCAGACTTCTCAATCATCGGTTGGGCGAGGAATGCATACCGCCAGTCACTAACGGACTTCCCATTGAAATTATTCTGCACGCAAAACAACTCGATT
TGGTCTCCGTGCTTGCCACCAAGAGAGGATAGCAGTTAGGAATGTAGCATTGATCCAATCATTGCAATACATTTATATTTTTGTTACTATACTTACTTCA
TTCCCTCACCTTACCTTTTTTTAAACCGCCTTTTATACCACCATTAGCTTAATAGCGGTAGAGTGTGGAAATTCCCGCTATTAAAGTGGCCTGTAaatca
gagttcaatttgACCCAAAGCCCATACTTAGGctcagtctcctgagtctcacgcgcttcctcgcagtctatagTGTACGCTAGAGAACGGACACATCTGG
CCCGTTATAATATTCCTGAACCTTGTGTTCGCTTACGTGACGATCCACCTAGACTAATTGCAGcgcatctccagcgccgacatgAGCTCTGGCAGTTTGT
TCAATTGGCTGGACATCCAGCCGTTATGCGCTACCGCCATTGGTAGATTCCATGCGAGGTCAAATCCAGGCCTGGCCAAGGCAGGTTAAATGTGTGGTTA
CAATTTTTGCATGATATATGCTCCCCTACAACAAAATTTTCACGAAGAGTAAAGGCGAAAACAATAACGTGGATTTGGGGCGAGCGTAgctgtaacgggg
ttacattcggaTAACATGGGTTACCCTCCCGAAAGTGAccgtatcactttctacatgTCTACGTATGTCACTGAAACGAGAACAGTGACTAGggtcctga
gagccactcAATCTTGGCTCTgggggcatttatataggttttACTATAGGTATCGTACAGTTTGTATTGCAAGACAAACTGGGCTCTTACttaaatatat
tcagtcttacttttaccTTATTTTTTGGTACTagtccccttcaggccatggactaagtgaactgccgttcactgggagtttgtataaactccaaagcaca
cacttcctctgtgcaacgtgcttgtgtgacagtCCGTCACAGTAGCTCTTGCGCTCGCTTTGAAGATGTCGGTCGATACGAACTACGTCCATGCCGGCCC
TCTTTGTCCGAAGCGATGCGAGGAACCCTGGTAGAAGGACTTGGACGTCGAGGCTCGTATAATtccttcagcgcctccatcgTTCTTGCTGGATGAAGTA
TAAGCGACTCCTGGCGTGAGACCGCGAAGGATAAAAATATATTGTACTCTCTTTTGTATGAGTGGAGTTAGCGTGGGCGGGGGTAAGGATATCTGAGAGG
GCGTGTACGGCAGGTTGGAGTTGTACAGCTCAAAACTGCGTACATGAGGTGTAAACAAACTTAGGTTTTACTAGCTGGGAGTCAATGGACAGATGCTGCT
ATTGGTTTAAAACCCATCGAATTAAATTGACAGCGATTTTAAACGATACCAATCCTGTTTGAAAACATCCAGATAAATGGTGGTTGGTTCTATTGCCAAA
TTCCATTAAATCAGATAGCGTTGAAGTTAGCGAAACACTGTTCCAGCGCTAACACAGGCCCGTTCATTGCCTGGTGAAATTGCGAGAAGCAACACTCTTG
TTCTCGGCCAGTGCTCATCGGTTGACGGTAGTTCTCCGTCGAGGGGGTGCGGATGCGCTACGGGCGAGCGGAGACTCTGACAGTAGTTCATCTGGCGCGC
CAGGATTTCCCTAAGGCGTTCCGCTTTGTATTGAATTTTTCTCATACAAAGCCGAAGTGACCAAATTCGGACTTATCCGGATAAAATACAAATATActct
ctggattttagacCGTGTTTGACTTGTTTGGCTCCAACCAACTCCTTTAGAAAGTACGCATTTGAGGAGgggttgaagcagctggttCGCGAAAAACAAG
TGTCCCTTAAATTTCGGATCCAGTCATCTTAGCCTCATTTCAGCCTGAAAAGCTCTTTGGGCTTTTTGTGTTCGAGTTAGGCCGAAAGAGCTATTTGCTT
ATTTTGGAAACAAAACAGCAATTTACCCTGCAAACCAGCAATTTCAACCCAAGTCAAACACGGCCttagatccagagtatctacaggtgagtagctcgac
ccaaaatCACTGTACGTTTTTATACTCATACGCTACCCAAACTAAGGACTCAATTCATTACTCAATCTTAGCTACCCAAATTTA