Description :
From Genome Similarity Track
Location :
Scaffold_873:2930- 5997
Transcript NameFunction/comments
Phyta_totarag11128hypothetical protein

Sequence
3067 bases(100 bases per row)
CTCATGGAGGGGAACGCAGCAGTAGGTTTACACGCGTGGTTCATGAGGCGCAGCGTGCCACCCGCCTCCAACGCGTCAATTCCGACATGCTTGTTTCCTG
TCGTCCGCGTCTTCAGATGCATGCAAACCCCTCGTTCACAGGGCCGTTCCTGCACGGTGGACCGAACAGCTGCAAGTGACCGAGGTACTCCCCGATCACC
TCGCTCGCAGGAATCAAGGTGGTCGTTATCAAGCCGCGCATACCACTTCGCAAACTCCTTCTAATGACAAGCGAACGGTTCTCCCCAACGAATTGCCGCA
GACGCCTCCGAACGCGCAGTTACGCTATAACCGCAACGAGCATAATTTAAGCTCACTTTACCGGTACGCGAATgcaggtattaataccgtaATCTAGGTG
TCAAGTGTCACCCCCAGTGTGCATACAAATCCCAAGATCAGGATAANATCTCCACCCTCTCTCttatgctgctgctggggttgTTTGAGGTTGGTGTGGG
CTGCTACTGGGGTGTTCTCGGTTGGGGTGACGCTTAACATATCGGAGCAAATCCTAATCTGATAAGGCTTAACGGCCAATCCGATTGGCCAATATGATGA
GGTGACACTTAACAAAGGCGGACACTTAACACCTATATTACGGTACATCCTTCACCCTTATTAGTCGTGTGATTTAATTAGTCATGTACTGACACTTTAG
TGACGTCACTAAATGGGAGCTTTAAGCTCATTTAGACCAAAAATACTGGTTTTGAACAGATCTCGCCGAGGCCTTTATTCCAGTATGCTCGGTTTGAAAA
TTGAGCCAGTATTGCTCATAGAATAGTGCTTTGAAACCCAGGTTTTGGACAGAAAAATGCTACACCAGAATTTAGTCGGGGACCGACTAATAAGCAGGCC
TCCATAAATTGGGCAATCCCAAGAAAATGGTCGAAAATAAGAAAACTAAGATTTTGTAATTTTCAAAATTAAGAAGGTCGTCTGGGTCGTGGTAGCTTCG
AATCCCCGCTAGAGTGCTTTTCACACTATGTCGGATATGGTTGGCCACTAGAACAACTCAAAAGCGAAGAATCTCGTAAGACCGAACCCTCAGAAATGTG
GGGGGCCAATGATCTTACAATTGTGAGTGAGAGTATCTGCATGGCTGGAACCAGCTTCTGGGTGTGCGAGATTATGTCCAAAAATAGGCTAGTCAAATAG
AGAGGTCCTCTCTGAGAGGAGCTGAAGCGAATTACAAGAAATACTGCTAGAGTATTTGTTCAAGCGGCAGACGGTGTTTCAAGACTTGTGGCTGGGAGAG
ATGAAAGAGTTCAACCTTTTATTGCTAATCCAAAGATGCGCTATACCAGCTCGTAAAAAAGGACCTGGCTTAATTCACCGTTATGCTGACCAAACACCGT
ACGCGCCTACTTAGGTACAACAAGCTTCCAGAAAACATTCACTCCATTAGTGACAAGTttgcccagctccagcggGCTCATCGCATGGAGAAACCTCTTC
GTAAGAGGTGTTTATTCGGGGGTAAGTAGGGCAATTACCCAAGATACTGACAGGGTTCGAGCAGAGCGAAGCCAGCTTACAAGAGTGCTGGGCTGAAATT
CACGAGCGGTTTTAGAGTCTGGCTGACTTTTATGCAGATAACTGCTATTTGTTTTAACGGCACAGCTAGAGCCCAGGTATTGCTAAACAGGTATGGCCAG
GTTTTCTTCCCAGGTATTGTCCAGGTAGGAATTTAACGTTTCGATAGCAATAAGTTACCGTCATTTTGCCTTTCTGCTTTGCACGCTCACATCCACCCGT
GGTGGAGCGCGAACCATGGAGAACGGCGGCTGTCATGGATCACATCAACCCCAGCGATGGCCGCGCTTCGCTGTTAACCAGACAAGCGGAGACGTTCATC
CTCACCTATCGCAAGCATCCGGCTGCGTACCGCGTCTAACCATAACTGTGTATGTCAAACAGCTCAATGACATGAACGGCACATGGGCATCTATTGGCAA
CAGCCAAAGAGCGGGGTTCCGGAACGCGAGGAATGGGGCACACACACAGACGAACATCATCCAGATGGTGCAGAAGGCGTCCGAGCCAatcagcaccttc
atgccTTCCCTGCCAGTGCTCACAAACGCGCTCAGCTCTCCAATTCACAGCAGAAGTGATAGGGTAGAACTAGTCATTTTCGAATTTACCTCGCCGAAGA
CAAGCCTTCCAACCGACTACAAGTTATTTTCGCTTGCTCGCTCCTCTCGTCATGTTGACTTTCGGGGTCATCATCGACCAACTCATCGACACTGAAACAA
CGGACTTGGGGAAGGACGTGGCTGAAAACGACTACCAACCATGTGGCccatcttcgtctccttgAGGATGGCGTACGTGACGGCGGCCTTTTCCAGGGCG
CGCAGCACTTCTAACGCCTCACCCTCGTCTGTCACATCGCCACGTGTGAACTTgagcaggcggcggcgcaAGTGCTTGTTCCTCGCCACAGTCTACTGAT
CCCTGAAGACCTTCAAGGACCATGTACCGTTTCTACACCAGTGCACAGAACCGTTATCAGCGTTTCAggagcgacggcgacggtTGGGTTCCTCTCGCCA
CCGCATTTTACGATGCAAGTCCATGTTTCAGTTGTCCAACGTCGACAGGTCAATACTGGTGAATACGGCGCTGGGGCACCAGGAGAATGACTGCGCAAAC
CCGTTGTAGGCATTTCCACCGGGAAGTACGTGATCGGACAAGCGATCGCGTACAACGGATACAATGCCAGAGTTCGCACCCTTCAGGTTTATCTGTGCCT
AAGTTAAAAAGGGGCGGCCAAACGGCCCGGACCGTTGTTCGAACCAAAGGGTACTCACCGAAGAAGAATCGAGTCGCCTTCAGATCTAATCGACGTGTCC
GAGCACAGTGAACAGCTGTCCAAACATGCGTTTGCACCAACCCGTACACAGCAACTGATCAACGGACTTATCGCTGCACCCGATTACGCAGGTTAGGACC
CCTCCGCTGTTGTTGATATCATGATTCCACCCCGGTCCACCAAGTTCCAACCGCACCCGGCTATCGT