Description :
From Genome Similarity Track
Location :
Scaffold_663:2930- 4346
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_663-fgenesh-gene-0.1Major Facilitator Superfamily (MFS)

Sequence
1416 bases(100 bases per row)
GCGGCGAATCGCGCGGAATTCATCTTGGATCTCGTCGTTCGTCTTGCCGTACGTCTCGGGAATGAGGAAATAGACGAAGGCAAGCGAAATCGCTAGCAAC
ACAGCAAACGGCACATAGGCGTAGTCATCGAGCGCGCTCGAGATGTACGGATAGCCAATGCCGACGATCAGATTGGCGAACCAAGCTGTGAAGACGCCAA
TGGAGGTCACCGTGGCACGAGCGTAGTCGGGGAAGATGTCGGCGATCACGACGTAGAGCAGAGGGCCGAGACTGACTCCGAACGACCCGACGTACGTCGC
CATGAAGACGATCGTGAGCGCCGACAAGTCGAAGGAGAGAGCCAACGTGATGCCGATAGAGCTAACGAGCATGCCGAACACGCCAGCTAACAGAATCGTG
CGGTTGCCGAAGCGACTCGTGAAGAGCCCCGACACCAGCGTGGGCAACATGTTGACAATGTCGATGAGGATGGTGCTGAGACGACCGTTGGTGAGACCCG
CGGCGGTGAACATGTCGGACGAGTAGTAGAAGATGGTGTTGATGCCAGTGATCTTCTGCATGCACGCGAGACCCAGCGCAATAATAAACTGACGGCGCAG
CGCAGGCTTGAGCAGCTCCGAGAGAGGAACGCCGGTGCCATCGCGAATCGCCTCGTGGCCAGTCTCGCTCCAACTCGATTGCGCCTCTACATTCTTCCTC
TTGGATTCAATCCACGCAAACGCGATTGGGACATTCTCCTCACCGAACAACCGAGTTAGTACTTCTTCGGCCTCTTGCCGACGGCCCTTCAGAAGCAACC
ACACAGGCGACTCGACCATGAAGAAGCTCGACAGCGTCAAAAAGATCAGGGCGAGGACGATCGGGAAGGCAGCAATAATACGCCAACCATCCTCAAAGTC
GAGGTAGAAGAACGTCGTCGAAACCAAGAGGATACCAATAGTGATGCCACTGTGAGTGATCACACCAAGCGAGCGCATGTGCGGCGGAGCCACCTCGTTG
ATGTAGCTGCCGAGGTTACCCGTGGTAGCACCCGACGCCAGACCAGCGATGAGACGACCCACCACGAACTGCCACAAGTTGAACGAAGCCGCCTGCAGAA
CGGCGCCGATGATAATGAGACCGCAGTTGTACACGAGCACGCGCTTACGACCGAGCTTGTCCGCGAACTTGCCGACGTAGAGCGCGCCGATCATACCGCC
GAAGATCCAAGCGTTGACGACGAAGATCCACTGTAGCTTGGTGTGACCCGAGAACATGATGCAGGTTCCTTCGGCGACGGGTCGAGCGTTGCAGTCTGCG
ACCTTGTTGAACTTGGAGAAGTTGAGCTGCGAGGTGGACCAACCGTACTGGAGCGACATGACGAGGCCGAGGAAGCAGCTCGTGTACATTAGCCACGTGG
GCTTGAGCGCCTTGCG