Description :
From Genome Similarity Track
Location :
Scaffold_2946:293- 2714
Sequence
2421 bases(100 bases per row)
GGGACATATATCCGTCGAAGAAGGGACAGCCACTCGCCATCCTTTGGCAGAGGTGAGGCGAGTTAGTCCCCGTCCTCAAGGACGCGTGGTCGGTGTAGAT
CACAAAGGGCCTAGAGCCCAGAAGGTGAACACGGAACTTCACAAGGGCATATTTCATTGCCAGGAGCTCCTTGTCATGGACAGGGTAGCTCCGCTCGGCG
GCTTTGAGCTGCCGGGACTGGAACGAGATGACTCGTTCCTGTCCAGCCGTGTCGTCCTGCAGCAATGCACACCCGATGGCGTAATCGGAGGCATCGCAGA
CGACGCTAAACGGCTTCGTCTCGTCCGGCAGAGCCAGGACAGGGGCCTCTTGGAGACTGGCCTTGATGCTGTCAAACGCATTCTGGTGCTCTTGTTCCCA
GCGCCAGTCGACGTCCTTCTGAAGGAGGCTCGACAAGGGCTTAGCGAAGCCCGCGTACCCAGCGCTGTACTTGTGAAGGTAGTTGGCCAAGCCCAACCAC
TTTCGAAGATCCTTCTGGGATCGAAGCGTCGGCCATGCTGCTATGGCCTTGACCTTGTCTGGGTCAGCCCGAACGCCCACGTTGATGACGAAGCAACCGA
GAACTTTAATCTCTGGTGACGCGAAAACGCACTTGTCGATGTTGGCGTAGAGCTTGTTCGCTCGCATCACGTCCAACACTCGACGGAGGTGTCCTAGATG
CACCTCCATGGCCGTCTTGCCTCCCTCGGCACGGCTATGGACGAAAATGTCGTCGAAGTACGTCTGTACGAAGGTACGCAAAGGGCGGAACAATTGCGTC
ACCAGGCGATTGAACGTCGCCGGGGGCGTTAAGACAAGCCCTGCGGCATGACGAGCCACTCCCAAAGCATGCCGCTTGGAGTGCTTACCGCGGTGAGCGG
GATGTCACTCTCTCGCATCAGGATTTGGTAGTATCCGTCTACCAAATCCAGCGCACTGTACAGTACGCTCCCGGCCATGTTGTTCAACAACACATCCTTT
CGTGGGATCGGTGTTTGGGCCGGCACCGTTGCGTTGTTCAGCTTGTTATAAGCGTGAACCAGACGCCACTTTCCGTTCGGCTTACGAACGCAGAAAGTCG
GCGTCGAGTGCGGGGATTTCGACTCCCGCACCATGCCTGCCTTCGCTTTCGCGGCGAAGAAGGCATCAATGACCTCGCACTGTTCGCGCGGGAGAGGCCA
TTGCCTCGTGACACAATATTTTGTGCCGGGCACGAGATCAATCTCGTGCCGTACGCCTCGATCCGGTGGGAGTTGGGTCGGTGGGTGTTTGTTCACCACG
TCCGCATACTCCGTCATTAAAGGATACACCGGATCCTTGGGGTTCTTAAGAAACTCAGAACCCAAGCGCGCCTGACGCTGCTTGTTCATGTCTTCCAGGA
CGTTCTCGTCCAAGACAGAGGAGGAGTTCAGTTCCTCCTGAGTGGTCTCAGGTCTCATGAGTACCATCTCAGCAATCTCTCCAGCCTTGCGGTTGGTCAG
GAAAGACTCAGCCGTCATTTCCTCGAGGTGCAGTATCTCTGCAACCTCTGGCAACGGTTCCAAGTGGACACCAGATGCCTTGACGGGTAAACCTGTCTCG
CCATCGAAGATGTGATAACACTCTTCCACCGGCCTTGTCGGAGGAGTCCGGGCCCTGGACTCCGAGTCGCTTGAAGCGACGTCGATCGGAACGAAGTTCG
GATCCGACTTGAGGCGGCGGCGGCGTCTTTGCCGACGGCTTCTGTGACGGGGAGCTTTGCTGCCCACGTCTAGGGATGTCGTCGCTACGACATCCGAGGC
ACTCGTGGCCTCGTGTGGTACTGTTGTACCCACACAGGAAGCGTGTTCAGCGCCTTCCTCTTCAGTTAAGGTCTGGGCGACCGCGTGTGGCACTGTGTTA
CCCACACAGGAAGCGTGTTCAACGCCTTCCTCTTCAGTTAAGGTCTGGGCGACCGCGTGTGGCACTGTGTTACCCACACAGGAAGCGTATCCGACGTCTT
CCTCTTCAGTTATGGTCTGGGCGACCGTGAGTGGAACTCTGTTACCCACTCTGAACACGCTGTTCTCAGTGTTCATGACAGCTGCAGCTGTCTGCGGAAC
TAAGTTACCCGCCTGTGGACCTAAGTTACCCACTTGGCCGGCGCCTCTTCTGGGCGCGGCCACCATCAAAACATCCTCGGAGTCGTCATATACGTCGACG
ACTCCCAAGCATCTGCCGGATGCTTTGGTACCCTGGCAGCCCTCGCGGGCGCCCCGGGTCCTGACAGAGGTGGGAACATGACTCACCAATGCTCTGTCGG
ACTGCGCAGGGCGGCTGGCACCGATTGCCTTGCCTCGCCAGTCGATCCAGGGCTCGTGCTTCTCAAGCCAGGGCATGCCCAGGATCATATCATATGGATC
CATATCGAGAACAGTGAATTG