Description :
From Genome Similarity Track
Location :
Scaffold_4686:293- 1869
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_4686-fgenesh-gene-0.0Major Facilitator Superfamily (MFS)

Sequence
1576 bases(100 bases per row)
TGCACAGGAACGGAACGAAGCTGTAGTTGGTGATGGCTTCTTCCACGTACGGAAAGCCAACACCAACAACGAGCGCACAGAACCACTTGAGCATGACGCA
CAAGCCAACAGCGTTACCACGCGCCGAGTCTGGGAAGAGCTCACCAATAATGGGCCAAAAGAGTGGGCCAATGCTCAAGTCGTAGCCGACAACAAACAGC
CCAAGCATAGTGATGGAGAGCCAGCCGATGCTGTGAGTAAGCGAGATCGTGATACCGATGCAGCAGAGCGTCACGAGGAAGAGCCCGCTCATGAGCATCA
AGCGCTTGGGGAGATGCTTGGAAAGGATGGACGCAATCGGGACTGGAACGACGTTCAAAACATCGATAATCATGAGGCCAACACGCGAGTCCTTGATGCC
GGCGTGCTTGAGAACACTCGACGAGTAGAAAAAGATAGCGTTGATGCCGACGAGTTGGTTGATGCATGTGAGACCAATCGAGATGATAACTGCACGTCGA
AACTTGGGGGCGAAGATAATCGCAAAGGGGCCTTCAGACTTAACGGTTTCGGTTTGTCCAACAAATGACGGTAGCTTGGAGCGGCGATCAACAGCCTGAA
TCCACGCCATCATCGTTGGAACGCTCTCTTTACCGTAGAGGCGACCGATAGATTCCTCCGCTTCAGCGTCTCGGCCCTGGGTGACGAGCCACACAGGACT
CTCCGGCATGACCAGGTACGACAGCAGCAAATGCCCAGCAGCCATGAAGATCGGCATGGCGGCAATGTAGCGGAAGCCGTCTTTCGTTCCCCAGTACCAG
AAGGTCGTGGCAACACCTAAGATACCGAGGGTCGCCGACAAGTGCGTGTTGATGCCGAGCGCATGACGGTTGTGGGGGGTCGAGATCTCACTGAAGTACG
TGTTGACGACGGCCATGGCGATACCGTTGGCAATACCAGCGATAAAGCGTCCAGCAGTGAATGTCCACGCAGTTGGCGCGACAACCTCGACAATACAGGC
GATGACCATGATGACCGTGTTGAAGCGCAAGGTCTGACGACGGCCGTACTTGTTGGAGATGGTGCCGGAGATGAAGCTGCCGCACATGCCACCAACGATC
CACGCATTGACAAGGAATGTCCACATGTTCTTGGTGTGCCCGGGGAACATGAGGCAGGTGCCCTCTTTGACAGGGCGACGGTTGCAGTCCTCGACGTTGT
TGAAGACACTATAGTTGATCTGCGAGTTGGACCAACCGTAGTGCAGCGAGTTGAGCATGGCGCCGAAGACACTCGCGTAGAGGACCCAGGTCGGCTGGAG
CGCCCGGCCCTCGCCCAGTAGAAGATCCTTGTGCGGCGACGCGACGACTGCGTACCCCGGCGTGAGGGATTGCTTGGGGGAATCGCGTGCGGCAGTCATC
GTGTTCTTAAATCGACCAGGCCAAGTAGCGAGCTGAGGAAGTGCTTGAGCGCCGGAAAATTGAAGAATGAGAAGAGAGGAAGGCGAGTCGAACGCGAATC
GTGTCCGCCTAGAGGGGGAGCGCCTTTAGGCGATGATCGATTGCAGGACCGGACAAGTTGCCCAACTGCAACAACC