Description :
From Genome Similarity Track
Location :
Scaffold_1184:293- 1420
Transcript NameFunction/comments
Hyaar_Emoy2814613hypothetical protein

Sequence
1127 bases(100 bases per row)
AAAAATGGAATTAATGGATGTAGACAAGGTGGAGGAAACTCTTCGAGCGTGCCAACGGATGGAGATTCGCCAGATAAAAGCGTCGATGGGATCAAAAAAA
TTTTATGAGCGAACGACCACTTCTTCAAATCCGATGTCGTCGAAGACAGCTCGGGCGGTGCGAGCGATCCGCGAAAAAGTCGAAAACAGCGGATCGGAAT
TGGACTCAATTGGATCCGATGAAGATATGGATCGTCGTCGAGTTTGTGTAGCAACTACATCCGAACAAACGAAAAGCCGGACAAGGATCACCGAACCTGA
CAGAAGAATGCTGGTGAAACGCATGGACGCGATCGTGGTGGACGATAGAAGGTGGGTACCCATTGTAGATTTACCTGACGCGATGATTGAAGGTGCTGGA
AGAAATTGATGTGCCAGAAGTGTGGTTGCAAAAGAGATCCTTCTGAAAAATATTTTCCGTGTGTGCAGCATGAGGACAGATACACGACATTGGCAAATGA
CCCGTGGAAGAATTTTTCAACTTGATCCGAAAGTAGTACATGACCACGAAGAATGCTGGAATGTTTTCGCCCAAGGTGGAGGAGATGTTAAACTAGGACG
CTCGCCAGGTTGGAATCTGGAACGAGCCGAGCGTTCTTGGCTTTGGATTTATGCATTTGTTGAAGGTCTACAGAAGGATCAAGAGATTAACGATCAAATC
GATCCGATCGCTAATATACTTAGTGATTTTACATTGGTCTCGTCAATAGCAAGTGTGAAAAGAGTAAATGAATACGCCCGATCACATGTGAAGATAGATC
TCGACTTCGCACCAGAAGAAATCACGCGGGTATTGGAAATACCATACTCCCGGAAAATGCTTCAAACAAGCAAAAGTGACGGGCAAGATCAACAACGAGA
AAGCCACCATGCTGTTCGACTCTGGCGCGGAAGTGTCGATCCTCGATACTACCTTTTCTCGTAAGGTAGGATGTGTGATCGACGAACGTCAAACACAAGA
GTGCGTTGGAATTGGAGAAAGTGCAGATTTGACGGTGGGGTGGACGGAGATAAAGATTACCTTGACGGATGGTTGGTGTAATATTTCGACGTTTGGGTCG
GTGATCAAGTCGACCAAGAAGCCATAT