Description :
From Genome Similarity Track
Location :
Scaffold_105:29298- 30920
Sequence
1622 bases(100 bases per row)
TTGCCGATAACATTTCCCGAGAACAAATTGACCCACAGAAACAACTCGGTGTTTTCCTTAAAGGATCTTGGCAACGAAGGGATGTGATCCATAGCTATAA
TCTGAAAAGGGTACGTCGATTGAATATTACCAGGTGATCCACTTCGATCCCCCGGCCGTCCTTTTCCCGTTTCACAATCTACACACTCTCCCTCATACCA
CTGCAAACTTCGGTACAACCCACGCCAATGGAAATTCGCCCTGATCCGTTGATAGGTACGGCCGATTCCTTGGTGATCACCCTCCAAACTTGTGTGGTAG
TGGTGCAAGAAGTCTCGCTGTAACTGTTCTGGAACCACCAAACGAGCCAGTTCAGTACGATCTTCAGTTTCGGTGGCCGATCTCGGACAGAAGAATAGCA
GCCCACTTTGGTCTACTTCATAGTCCGGTGCGATCAGGATGCACACCTTAGCTTCAGCTGCCGATAATTTAGCTACGTCTCCAACCAGATATATCTTCAA
ATTAGATATCCAGTTTTCTTCGTCTTGTGCCTGCTTAATACGACCAAATCCGTATCTGCTGCACAACCTCTTCCTGTAAAATCCAGGGCTGACAACGTCT
TCTCTGGGCTGTTCGAGTGATAGCCGCTACTTTGACCGCACGATCAACTCGTTCTGGTAGTAGTAATTCGTTTAACCAATTGAGAGTAATCAGGTCCTGA
CGCTCTTGATCGGAAACCACAACTGTCCCTTTCTCTTGCCGTAGAGCTTCACTCGCCAATCGATCTGCACTCTGATTCCAGTCCCTCTTCATGTGCAAGA
ACTCGTGGGATGGTCACGATCGTAATCTCTCCATAGCTCTATGCCCCAGCAACTGCAGTCCCAGCGCTTTACAGTCGATTTCTCCTCGCATTTGACGGAT
CACCAAATTCGAATCTCCGCAGATAATCACCCGTCCCCTTGCCTGATCGGCAAGCAAATCGAAACTAAGGAGCAACCCTCGGTATTCTGCTTCATTCACG
GTTTTATCAGGGGTATACTCGGAAGCAACATCCACAATCGTCCATTCCGGCAGTTTCCATATAATTGCGCTGTATGCTCCGCCCTTTCTTTTCACCCTAG
TTGATCCATCGAAACTGGCTACCAGCAGGTTTTCATTTACACCTACTGTGGGTGGTGGCATGCTTCTCGTCTGTCTTGGTTGCTTTCGCGGGGCGATCGC
AATCAAAACTTCATCTACTTCTTCACGAGGTGTTATACTTGCCGCAAGCATCCCGAGTATCTCATCTTCTCCCTTTTCAGATCGCCTAATTTCCAACGTC
CAGTTCGATAGTAAAGTAGCCCATCTTCCCAATCTTCCGTTGAGGCCTGAAGATTATAATAACCATGCTAGTGTCGAACATCGCGTAAGCACCGTAATCT
CACGGGATACTAGCATGATAGCAGATATCTAGCATTCAGAGGAGAGCCAACACTTCTTTCTCCACCATCCCGTAGTTGACCTCGTTGGGCTTTAGCGTAC
GACTGGAGAAAGTGACAGGCCAATACACACCATCATATTCTTGAAGCAGAGCAGCTGATACAGCCCACTTACTAGCATACACCACGATCACAGGCGATCG
ATCGGGATCGAAATGCTTTAAG