Description :
From Genome Similarity Track
Location :
Scaffold_105:29297- 30930
Sequence
1633 bases(100 bases per row)
CTTGCCGATAACATTTCCCGAGAACAAATTGACCCACAGAAACAACTCGGTGTTTTCCTTAAAGGATCTTGGCAACGAAGGGATGTGATCCATAGCTATA
ATCTGAAAAGGGTACGTCGATTGAATATTACCAGGTGATCCACTTCGATCCCCCGGCCGTCCTTTTCCCGTTTCACAATCTACACACTCTCCCTCATACC
ACTGCAAACTTCGGTACAACCCACGCCAATGGAAATTCGCCCTGATCCGTTGATAGGTACGGCCGATTCCTTGGTGATCACCCTCCAAACTTGTGTGGTA
GTGGTGCAAGAAGTCTCGCTGTAACTGTTCTGGAACCACCAAACGAGCCAGTTCAGTACGATCTTCAGTTTCGGTGGCCGATCTCGGACAGAAGAATAGC
AGCCCACTTTGGTCTACTTCATAGTCCGGTGCGATCAGGATGCACACCTTAGCTTCAGCTGCCGATAATTTAGCTACGTCTCCAACCAGATATATCTTCA
AATTAGATATCCAGTTTTCTTCGTCTTGTGCCTGCTTAATACGACCAAATCCGTATCTGCTGCACAACCTCTTCCTGTAAAATCCAGGGCTGACAACGTC
TTCTCTGGGCTGTTCGAGTGATAGCCGCTACTTTGACCGCACGATCAACTCGTTCTGGTAGTAGTAATTCGTTTAACCAATTGAGAGTAATCAGGTCCTG
ACGCTCTTGATCGGAAACCACAACTGTCCCTTTCTCTTGCCGTAGAGCTTCACTCGCCAATCGATCTGCACTCTGATTCCAGTCCCTCTTCATGTGCAAG
AACTCGTGGGATGGTCACGATCGTAATCTCTCCATAGCTCTATGCCCCAGCAACTGCAGTCCCAGCGCTTTACAGTCGATTTCTCCTCGCATTTGACGGA
TCACCAAATTCGAATCTCCGCAGATAATCACCCGTCCCCTTGCCTGATCGGCAAGCAAATCGAAACTAAGGAGCAACCCTCGGTATTCTGCTTCATTCAC
GGTTTTATCAGGGGTATACTCGGAAGCAACATCCACAATCGTCCATTCCGGCAGTTTCCATATAATTGCGCTGTATGCTCCGCCCTTTCTTTTCACCCTA
GTTGATCCATCGAAACTGGCTACCAGCAGGTTTTCATTTACACCTACTGTGGGTGGTGGCATGCTTCTCGTCTGTCTTGGTTGCTTTCGCGGGGCGATCG
CAATCAAAACTTCATCTACTTCTTCACGAGGTGTTATACTTGCCGCAAGCATCCCGAGTATCTCATCTTCTCCCTTTTCAGATCGCCTAATTTCCAACGT
CCAGTTCGATAGTAAAGTAGCCCATCTTCCCAATCTTCCGTTGAGGCCTGAAGATTATAATAACCATGCTAGTGTCGAACATCGCGTAAGCACCGTAATC
TCACGGGATACTAGCATGATAGCAGATATCTAGCATTCAGAGGAGAGCCAACACTTCTTTCTCCACCATCCCGTAGTTGACCTCGTTGGGCTTTAGCGTA
CGACTGGAGAAAGTGACAGGCCAATACACACCATCATATTCTTGAAGCAGAGCAGCTGATACAGCCCACTTACTAGCATACACCACGATCACAGGCGATC
GATCGGGATCGAAATGCTTTAAGTAGTTGGAAT