Description :
From Genome Similarity Track
Location :
contig_15:292949- 305230
Transcript NameFunction/comments
g4030.t1ETO67876.1 hypothetical protein F444_15242 [Phytophthora parasitica P1976
g4031.t1XP_009516806.1 hypothetical protein PHYSODRAFT_309854 [Phytophthora sojae
g4032.t1hypothetical protein
g4033.t1RAW33169.1 hypothetical protein PC110_g10495 [Phytophthora cactorum
g4034.t1KUF79267.1 serine/threonine-protein kinase [Phytophthora nicotianae

Sequence
12281 bases(100 bases per row)
GCGATTCGAAGGCGTCGCTGTAGTTTGTTGCTCCGAATATTCTAGTTCTCCATGGTTGAATCTAAGTTTCCTACCCAGTACCCCAGATATCTTGTTGTCT
CTTTCGGTTGTAACACTTGGTATCCATGCCATTTCGTAGGAGTCCCAGCCATGTTCAATCCTATTAGTACACTTTTTTTTGCGGTTGTACTTGTAGTCCA
GATAAATCCCCAAACTCCTTCAAGATGTTCTGTACAATTGGGATTTCCTTCGCCCAACCAATTATCATACGTACTTATACCTGGATAGTTGAGGTGTGAG
CTCCAACTGTAAGACGATAGGACAAACGAAGCCGATTCTTAAGTGACATCGTGCTGAAAACCAAGCATTGAAGGAACACAAAGTAAAATGCGTTTTGGCA
CAGGGTGGCTTAACTCGACGACTGCATCCAAAAAGGTACACGTGAAGTGCGTGCTACGATTACGGACGTGTGGAAAAGACTTTATTTGGCTCGAGCCACT
ACTATTAATAGTGTTCCCTTTATCTTCGTCAACAATGGTGGCTGTCGCGTAGGTTGCATTGCTGCACTCAATGGTGATTATGGGATGCATGTAAAGATAC
ACGTGAAGTGCGTACTATGATTATGGGATACTACACATTTACTGTGTACTCATCGTGAATCGTTTGAGAATCTGGAAATTATTTCGTTTAGAAGTCCTTG
GCGAATCCTTTTATTAAGGGCAGTGGTCATTTGTGCCATTGCACGAATGGATAGCTGAGCAGTCTTTTTAACTGTTATGCTTGGTCGTGAGGGATCCGTC
GGCTCGTATCGATTTTCGAGGTAGTTTCTTAGCCTGAATACGGTAGGCGAGCGAAGTGCGTTTTGGACCGCAAGCGCAATAATGGGAAACTAGTCCAATA
CGTAAAGTACAGGTAAGCTTCTAACCTAGTCGGCCGATCAGTGTTTTTTGTTTGTAATTTGTATTACTCGTGTGGTAATGCTCTAAAAGTCGGCAACCAG
TTTTATAGTGCAGTCTGCCGAGCCATTTATAATACTATTTGTATTAAACTATTGCGAGCTCCAGGACTCTGCATCAGTTGTTTTGCAGCAAACCTTTTGC
TAGAGCCACCGAGTTTAGTTGTTTTGCATGGCCTTTTCACACTGAGCAAGAGTCAAACGTTTCCGTCTTCATCCGCAATCATACAGTTCACGAGGGATTG
AGAGCTTTGCGTTTCGATCATCTGCCCTGGCTGAACTACACAATGTGTACACATGCTGACGCGAATCATCACGCTTTCACAAGGGCTTTGGTCAGTTCGA
AACTTGCGCTCCAGAGCCCAAGCCACACTGCCCTGCTGATCGACCCGGACCCACCATGCGCTTTTGCTACCTCGTCCTATTGGCCGCAGTTACCCTCTTG
CAGGCGGTAATGACGTTGCAGCCATCACCGCCGCGGACTCCAAGCAGCTTGCTCAGCTGGACGCCGTTCGCTTGCTCGCTGAGCAGAACGAAGTCAATGT
CGCCGTCAACCGCCTCCTGAAAATCGTCGACACGGAGGACGAGGATAGAGCGGCGTCGGCGTCTTTCCTTACGAAGCTCAAGCAGGCTGTCTGGAGGATC
AAGATTACTTCTTGGTTCCAGGCCAACAAGACCCCGGCGCAGGTTAACCAGCTAATGCTGAAGCAGGGCAGCAAGATCGACTGGGCTCTGGCTACCGCGT
ATGCATCGTACTTCCGCAACATGAAGTACGGCCCCTTCGCTATCGACATGTATGACAACGTCAACAGCAGAAACGCGTAACTTAGTTGTTCGAATAGGGG
TAAATGCCATGGAGCCCATGGCCCAAGCCATCGATAGTCGAGTTGCGCACATATCATTGGTAATTGAATGGACTTGTAACCTGAAAGTAGCAACGCTAAG
AGGCGTCAGCCGACATCAGCACAGACAGATAGGCATATGTGGGGGAATACGCGGAAGCTTCTACGCGAAAGCTTGTAAGCGAAGCTGCCGGACTACGCCG
TACCGCGGTAGCCACTACCGACCGGCCAGTCCAGCATACTCCACCTCTGTTGGGGTTCCAGGCAGTTCCAACCTGGAGCTGCAGCAGAGATGAAGTTGAC
TGAGATCCAGTGCCCCATCGCGCATTTTTCTCTTCTCCGATTTAGCTCAGGATCAATGATAGGATTCAGGATGGTATCGAACCAGATCCGAAAGGCGATC
CCAGCTTGGAACGCATATTGCGATTCGGAAACAGATGGACTAAAATGGATCGAAAGTGGACCGCAGCGGTGCATGCATTCGTTTCGGTGTCACTCTGCCA
TGGTCTGCTGGGTTTCTGCAGTTTCAAATTTACATTTGATTTGCTATAAAAACTTCCTGTTGCCAGGCTGCATCATCCTACATGTACATCCAAGGGCGGC
CTCACAGTTTTTGACATGCTTGCCACTACAGTAATCTGCGTTGATATAATACATGTAGAACATCCAAATACATCAACGCCTTGTGGCCGATGTAAACTTG
TTTCTTCTATTATCTCTTCGTGCCCGGGGAATGAATACTACATGCATTAGGCACTACCTACAGCGACATGCTCACAATTTTTACCTGGAGCAGCATGCTC
ACAATTTTTACCATACTGCTCACATACCAATGGTAATGGGTAACTTCATACTGAATGGACACGATGTACTTCTTGATATGCCCGACACCATTCCCTTTGA
CCGCTATACACACCATTCCCTTTGACCGCTATACGATTTTTATCATTTCATGTATACTGTAATACTTCTTACCGACGCAACTTGCGGAGGACGTACAATG
CAGCAACCAGAACAGATACCGATGATACTGCTGTGCGCATTGACGCGGATCCCCCATTCGTAGCCTGGTCAGAAATCTGCGGTGTCCCGGAATTTCCATT
TCGAAGCAAATACTGCCTGGCATAGCGCAGCAGAGGCACTGTACGCCCCGAACTCCACTTCAAATCCAACAGTTGCACAAATCGAAGGAAAATCGCGCAA
CAAGCCACCGAGCTCAACGCTGACGCTGCAGCAAACTGCACGAACGTAAGGAAAGCTCTGCGACTCCCTCGTGACGCATACAACTGCATCACCAGCAGTG
CACTTGACATCGCAGCCGTCCGATTAAGCGTCTTCGAACCCGGCATCTTCACCAGCTCCTTGCATCCGTTCCACATTCTCGACGTCACAATCTCGTTGAG
AACCTGCTCACGCGTCGGTGGCGTACGCACAGTACTAACCACATCTGGGCGATGGAAATCGAAACCTGACGTCGGCGTTGACAGCAAACTCAGCACCTGG
TTGTGTTGCGCCTCAACTTGTTCGTCCCCCCGCTCCCTATTTTCCAGCACAGTTAACGCTCCGTCGCCTGAGTCTGCACATTCACCCTTGTCTTCGTCAT
GGTCACTACTGTCACTGTCCTCCGCTGGAAGTAAAACTTTCTGCACGGAATCCGGCAGCAGCGGCAAAAGTCCGGGTTTCGTCAGCATGACCTGAGCCTC
TGGCGGCATCTGCTCCATCAACCTCATCTGCTCGGCCCTCGTCAGCGGCAGCAAAAATGGCACAAAGGGTGCCACTTTATCGGAAAAGCTTGTATCTGTG
AGCCACTCCAAAAGTGAAGTTTCAAGTAAAAGTTCCCGTGTAGATTGGGGCAGGAACCCTAGCAGCCCTTTTGTCCGCGCTTCTTCTTGGTACCATTTCC
AGACGGGAACACTCCACGAGTACAAAAGCCCCAGCGAGGCGTAGGCCAGCGCCACGAACGCGAGCATGGCTCTCCTGGATAAAAACTCAGCGAGCAGTAC
CGTGAGTGCAAAACTCACGGTGAGGCAGCTGGCGACACGCAAAAGCAGGAGCGCTGCCTCGACTTTCGAGGACACTTGGGAATACGCGATATGCACCAGC
AGCAACCAGGTCAGAGGCGGCGAGATGGCGACAAACACGACGAGGTGGTCAACCGCGAACGAGTCGAAGTCCAGCACCCACCCGTTGTTTGAGGGCACAA
AACGCCTCAAATAACGTCGCGACTCGTCGTCCAGCCACGGCGCCAACGCGAGCAGCGCGAAGCTCAGCAGTAGCAGAACCGAGCTCAGCGCGAGCAGCTG
TACGCTCAGCGGGTGTCCGAAGCTGCGCCGCAGCACGTGGTCCAGCACGCGCACGTACAGCGGCCGGGAAGACGTCATGGGCTGAAGAGAAGAATGTGTG
GTTGAGATGACAGATCGGGGTTGTATGACGGAAGGAAGGTTTACCTCCATTCTGTCATACAACCCTCATCTGTCATCTACTGTACACTTGCTTACGTGAA
AGCGATGTTTACGATGTTGGCAAGACACATCTTGTGATTTATTGTGGTTTTCAACCTTTTTGCCGCCTGTTTTAGCTCCACATCTCGGAGTGGCTTGTTT
TACAATTCGGGCCTTCAATAGGGATAAGTCACTCTATCTTGGTGGGCCGAACAGCTCGATCACATACTCCTGCTCATTATTGCCCCTTTCGTCCGCCACA
CACTTGAGACGTCGTTTACGTGAATAAGGGCCACAGTCCGCCATCTAAATTCGTCCGCGTAGGTTATGGTGCAGCGAAAATTGTGTGAATGGTTATAGCG
TGTTGGTGGCGGGCTGAAGCAGGTATTCCACTCCTTTATATCGTTCATAAGCGGCAAAACGGAAGTGTTGTTTTCATCTATGTATTTTGGCGAAACGGAT
GCCTCCGATCCAGAGATGCGGGGTCTGAGATAGCGGGCATCTCAGAGATAGCAAAAAAGAGGGTCCGCAATACTGGGAGGAATAGGTTTATTAAAAAGCT
GTGAATTCAACCCGACTTAGCACCTACCGTTTTTGACGGTTTCAGACGGCATCAACGAGTGGTCTTCCTGCTTCAGCCCACTCGCACATTTTTCTTTCCA
CCATGACGCTTGGAGACGATTTTCGCTGGCGAGCCATAGCTTCGATGCATGTCTACAACGTGTTATCTGTGTACGTTTCAGAGCTATTTAGACCGAAACA
GCGGACGCTTCGCCGTCGGGCTTGGCTGGAGACAAGTCTCCGATTTGGGCTATGAAATAAATCAACCTAGCCCCATGCACAGGTCCGAATTCAAAACTGA
CCACTCAGAGTTGTCCAGCTAAAACGGGCGGCAAAAAGCTCGAAGAGCACAATAGTTTCTTAGCTAAACACAAATACGCGTACAACATGTATTGTGCTTT
GCAGCCAGTTTGTCCAGCTATTTCGTGCATTAGTTAGTACTCGTACTTAAACCATAGAGGCTTTGAGTGGGTCTTTCCGAAGTCATGTTTCATGCACGAC
AAGGGCAGAAAATGGCGCTGTTAGAATACTTTCAGATCTCCCAGACACATAATGGGCGAGTATGAAGCATGCACGATTGACAGCAACTCGAACTCGAGTA
CGATTTATAGGAATCTTGTGCAAGACAAGTCGTACGAATTGCCAAAAAGAATGCACAATAATAGAGGACCGAGTCTTTTAAGAGGTATTTTAAATACAGT
ACACGTAATAAATACATTGGAGGTACCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGAAGAAATGTTCCCGATGACTGTAAAGTTCGCCCAATCCTGTTTA
CTATCGCAGCAGAAAGCATGCAGTGATGAGAAAGACCTATTCCCTCATTGCTCATTGAATTGAGACATAGTGTGCCGATATCAAGCCAACAATTTATTTT
AATAGGCTGTACTACATGTAGTACTCTAGTACAGCCTATGATTGATCGTGCTTGTCGCGATGTGGGACCCGCACGCAAAAGTATCTTGCTCGTGCCAAGC
CACATTTCTCCAGTACTTTAGTAGAGCTGTGCGCTGCGCGGAAGCAAAGCCTCAAGATAATTCAAGGCAGTTCGCACATGGGAAGTTCGTTGTGACCATC
ATGATGCAATGACGCTCATCCGAGGTGCCTGTCGCCGCAAGAGTCTCGCACCGTTTGTGTGGTACCGTTTATATCGTTCTGCAGCTCTCGCGGTAAAATT
TGAGATTACAGCCGTCGAGACCTCGATTATCGCAGATCGAGCTAGATGTGACCCTGGGTTTAAGCCACAGGCGTCGTTTAGCTTCGCTAACATAACCTTT
ATTGTGCTTTTCATCCATTTTGGCAAACTTGAGTTCCATTCCCGAGATAGAGGGTCCGAAGCAGAGATAAGCTCCGAGATAGCAAACGACTAAGTCCGAA
ATGTAGCAAGGGGGAAGGTTTGCTCTGCTACTGCATCCTGTTATAGAGGCTTACATGCAGTCCTGGTTTAAATACACATGCTTCGGAAACAACATTTGTT
TAATGGACCCCGTAATCACCGGAGAACAAATCAATTGTACAGCACAGACTCTTCCGATCGGTTTGCCGACGTGTGAAACCAACCGCCTTGTGAACAATTA
CGGTACATGTACAGATAACGACGGATCGTGGGCCGGCGGTACCATGGTGCTTAGACCTCAGTTTGCAATTTACTCTCCACCCCACAAGCACCCGAACACC
AAGAATCAACACTTAGCTATGCGCTTCTTCTACGTCACCCTCGTCGCTGCGGTCACGCTTCTTGCAAGTGCCAACGCTGTCTCCACCAAGCAGAACCAGA
TCTCCGAGACGTCGCCGGAGATTGTGGCTCGCTCGCTCGCTGCCGCCCAGGACGACGCTGCTGTCAAGCGTAACCTGCGCAAGTACGTCGAGGAGGACGA
CCTTGACTCCCTCGACTCCCTCGACTCGTTCGATGAGACCGAGGAACGCGCAAAGGTGATCAATGTGAAGCAGCTCAAACAGCTTGCTAAGACAAAGAAT
GCGCATCTACCGGTCAACTTTGCGAAGCTGAACTTCAAAATGCAAATGAACACGGTCAAGACTTGGGCAAAACAAAATATGAACCTGAAGCAGTTCGCCA
CAAAGCTGGGACTGAAGAGCGTGAACGACGTCGGCAACAAGAACTACCCGGTTTTCAAGATGTTCGAGGCGCGGTTTACCTAGTCGTAGACGTACTCCTT
CGCTAGGCAACCACGAATAACCGATTTTGTAGCCGACGCTTAAATCACTTGTATCGAGCATTCATACGACAGTTTGACGACAGTGCTAACTAAATGATAT
CACCGGTCAATAGTATCCGGCAAGCGCGACAAAACTGAAGCAGAGCGTTCAAGTAAGTGCATTTATGCTTGGCGTCTTCTCTTCCTCTGTCTAAATGCTA
AATTGCGAGCGTTGCTACTCTGTTCGTGTTCTGTCTCCCTAACTAGATGAAACATTATGGTGATCTTGAGTTGTGTTAACCGACAAGAGCGACGAGAAGA
GCTAATCAGCAGACCGTTCACCCCAGTAATATACCGCATCGCTGCCTGCTGTACAGTCATAGAGGTAGGTGGTTGCGCCCCAGTCTCGCGTTCAATTGCT
GCAGAAGTGTGCTGCAGCATAATTCGCCACTCTGAATAGGTTTGCCGCTTTCTCCGTGTAGGTAGATCACCTGCGCCTGCTCCTCCTTGGTTGCGCTCAG
CTTCGATGCGCTTCAGACCGGCGAAAAATGTTTTCATGCCATCAATGTAGGCAACAGCGAGTGGCAGTTTCTTCTGCCGGAAGACGTCTTTAATAGCACT
TCGATAGCCGCTGAGGGTTGTAACCTTGAGAGTTTTTTCAGTATCGTCCGTCTTAGCTAGCAAAAGGCCTCACAATCTTTCGGCGTAATACATTGGCGTC
AATTTCACCGTTAGAGTCAAATACCTCGCAGAGTCCGTCTTAACCGCATGGATCCATGCAGAAATACCGCGGCGATAGCTGCGGTAAGCCGTTTGAGTCC
TGGAGGTTGTACATGCGCGGCGAACGTTCTCCGCGTTGAAAAACTCGGTGGGTGGCGTTGAGGAGCTCGGAGTAGCACCATTGCTTCTCGCAATAATGGT
GGGGTCTTCAGGGGAGGACAATCACGCAGAACGAGATGGGGGCATGGGGAAATGCTGGGGGCTGAGGGCTGAGGGCGGGAGCTGGAGACTATGTGAGGTG
CTCTGAGCGATTCTAGCCAACGATATAGCCCAGTCTATCGTACGACGAGTTGTCGTCACGCTGTCAGACGGCGGCTCTCAAAAGACAAGATATGTCTTAC
GAAGGCGCATGAATCAATGATGCTACAGTAGGCAATGCCGCGATGATAATACGGTACCATAGTGTTGGAGATATTCTGGTGGATTACATGTTATGTTGGT
CGCAGGAAGACACATCGTGTGAGCAAGAGCTTGCTGCTCTTCTTTTAGCAGAGCTGCGCCAAACAAAGCTCTACATGTATGGGGATAACAGGAGCGGTGA
CGGTCTCTACTTGCTTGGAACCGATACATGTAGCGTTTTGTTGTCACCTGTGTGGCGACGATGGATTTGCCACTCTCTGAAAAGCAGCGAACTGATTGTA
ACAGCAGAGAAGCAACATTATTCATCGTCTGCAATTTCCACAACGAATCAATTGGAAGTTTCCAATGAAGTCGTCCCGCAGATGGCATGCAGTGTTCAAC
GTCGAATTTTGAATCGATGTTCAACCTAACTTGTGTTGGTACAGATGTCCCCTCCAAATCTGCAATGGTCGGACCAATAAAGACTGCTAGGTTACTAGAT
TAGCATAGGAATACATCAAGAGCCAAATGCACTGCATTATTCCGAACTACACGACTAATAGCAGAGCATGTGTGCAACCTGCATGCATGCATGCTTCCCC
AAGACCGGTAAATGTAACTTAGATTAGTACAGCATCGCGGCAGCCAGAGCAAATCTTCCGCAGATCCATACTATCTGTGCAAGGTAAATTGCTGTACGCA
GTTCTCCCTTTGCCGGGGAACTCCGTACATGTTTTGAGAGAGAGAGAGAGAGGTCAGACTTGTCTATTTAACTTTACGGTTTACAAGATGTCTGGCATTT
TCAAAGCCAGGATAGCAACGCCGATATCGGTTCTCGCCCGGTGGTTGTACTTGACTCACCGCCGATGGTGGCGCCTCTTTTGATTGTCTCGACCGTATTT
GTAGACAGATGAGCAATCGTGTGCCCTGAATTATGGTGTGCAGTCCTCTTCGTTCTCGTGTTGCCAACGCACGTATGTGTCTGAGTCCAGCGTTTAGAAA
TTCTTGAACGCTTCCGTGCAGTGTGACCTTTCCACCGTCGTGAACGACTCGATTACGTTGAATCCATAGTACTGTGATGCAGGTGGAGCTGAGGATCCAC
CATACCCTTTTCCAGTCTCCTTCATACTGCTCCGGGTTATCCGCTACTGTTGCCTGGAGTCGCTGCCGGATCGCAGCGGGTATCTTCGGCGGTTTGCGTG
ATATGCAATTTCCCTTGAAATTTGCGTATGTGCTGTTGTGCCCAGTCTTGCCCTGTCCATTGACTGATGAGCGCTCGCCAGCAGGCTTGTGCAGACAAAC
AGTCCCAAATGATGATCCTTATACGTGTTTTGCAAAGGGGCCAGAAAAAAATGTTGACGTTGAAGCATATGAAAAAATTCCGCTCAATTGAAGACTGGCT
TGTTAGGCTCGGTGAGGTTTCGAGCTGATAAGCGCACAGAAAGCTTCGACTTGATTTCAATCGATTATTTTCTAATACTACGTGTGCAAGAAGAGCCTTC
ACAGTCTGAAGAAGCCTATCTCATCTCCGACTTGGCCTCATCAGTCGTAAAAAAGGCTGTGTTTCCTCCTGTAGTAGTACACCTCGTATCCATCAGCAAG
ATCCCAGTCGACGTAGCGACCTTGCGCCTCCCGGTTCCGCAGCATTTGTTTGACTTCTTTCGGGTTCATCCCTGAGCGATACCAACCACGGTACGTCGTT
TTCGCGGCATACCGATTAACCAAGTAGTCGAACAACCCCTTCTCCTCGCTGCCGTCTTTGGCGTTTTCATCGTCCTCCTTGCCAACGCTCTTGTCAGCCC
GCAGGCGTCTCGTGCTCTCAACATCAGCAGCGAGGGCACGGACAGAAGCCACAGCGTTAGCTGAAGTCACTTCGCCGATGTTCTTTTGGTCAGAGGCCGA
GACCGTGTTGCTGCCCGCCAGAAGGACAGCCGCTGCTGCTAGAACGAGGTAGGTGAACCGCATAGTCGTTTGAGATCGGAGCTTTTTGAGGCTGGGTTGC
TTGAGCTCTGTAGAGTGAATTGCGAAATGGAAGTTCGTAGGAAGCTACCGCATAGGAATTGTTTACACTATCCGCGAGCCGTCTTGCTGTCCGCATTGAG
CGTGTAGGCAAAGGTGCGGGCTTCGCAACTGCCGGCAAAGCTCATGATGGCAGCCCAGGAAACGTATCTTTTCCCCTGGTCTAGAAAAACGGCTGGCTTG
GGCCTGGGAAGACTTAATCGCACTAATTCACAAATCACAAATTTAGTGTCGGTCAATTCCGACCCGGAAAATGGCCGCGGAGCGCAGCCCGCAGAGTCTC
TGGCGCGCGGCGGCAGGTGCGCCCGCCACATTCCTCACACCCTCCCGCATCTCCTCTCTCCAACGCACTATTTGCACGCTCCAACCTTTTGTCCCATAGA
GAAATTGGCCACCGCCGACTTCCTCCTCGTTGCCACGGGCGCAGGCTTCTCGGCCGACTCGTCGCTGCCAGTGTACGCAGACATCGCCAAAGTGGCGGCC
TACGAACAGATGGACGTGGAGTACCAGGACCTGTGCGACCCGTTCATGCTGGAGCAGGACGAGGAGATCTTTTACGGCTTCTGGGGCAGCTGCACTAACT
CCTACAGGGACGCGAAGCACCACGCAGGGTATGAAATCCTACGCCGGTGGAGAGACACCATGAAGGCGAAGGCTACGGCCACTACAGGCAGCAGCCGAAA
GGAGAAGCAGTCAGCTTTTCGAGCGGCTTTCGAGCGGCTGAAACAGTGTGGCGATCTTCCGAGAGGAGTCGCCACGGATTCCGTGACGAACGACCCGTTC
TTCATCTATACGTCCAATGTAAGGTGCTCGTTAGGGTGAAAGGAGACGGCTGTTAATGCTGGCTTGTGGCAGGTGGACGCGCACTTCCGGCGAGATTTCG
ACGGCAAGGAGATCTACGAGCTGCATGGAAGTGTCGAGACGTGGCAGTGCGCGGGAGACGTCGAGACTGGCGCGAGAGAGCCGTGCCACAAGATCTGGAA
GCTGCCGGCGGACTTCCGCTTTGATTTAGATGTGACCACAATGAGAGCGCCGGGCGCAGATGCGACCACGTGCCCCGAGTGTGGAGGCAAAGGCCGCCCC
AATGTGCTCATGTTTCATGATAGGCAGTGGATTGGAAACGTGTCGGAAGAGGTGGGTGTGCTGCGAGGGATTGGCGAAGGAATGTGTGGCACGTTAATGC
TCATCTATGCTCGTGCTGTATTATGCTGCAGAATGGCTACATCGCGTGGGAGGCGGTGATAGAGCTGGTAAGTTGCTGAGCAAGTTATCGTTATCTACGT
GTCTGCTCATACTACTTGAATGTTACTGCTCTACTACGTGCTCTCATTGCTATAGATGCTGCAAGAACACCCGACGCTCAATCTAGTTGTGCTTGAAATC
GGCTGTGGAACTCGGGTTGGTGCCATATTCGCTCTAGGCACAAAGGCCGTGTTGAAAAATGTCCTCATTCTGGTTTTGGTGCTTGCTCTAGGTGCCGTCT
GTCCGGAAAGAAACAGAGATGGTTGTCGCGGATGTGCTTCAGGCCTGCGGTCGTCCGCAGGCGACGCTCATCCGTATCAACCCAGACATCCCAACTTGCA
ACAATCCGGTCATTTTAGCGAACGACCGCTTCCTTTCCATCCGTTCAAAGGGTTTGGAAGCTTTAGAAGGCATCGATCAGGAACTCCGCAACCTTCGACC
AAAGGTATAATGATAACAACGTTTGAGTTAGGGCACCACGAGAGCGGGGCAGGCGACATGATTTTATATCGCGACGGGATTGTGGGCATCGATATTGAAC
TCGAACCCCGCGAATTTTTCCTGGTCTTCTGACGCGATTCGATCTGATCGCGAGTTTACATTGAGTACGTCATCGAAGTCCTGAGCCGCTGTATCGCAGT
TTGCCTTCTTTTCATCCACGACGGGGACGAGAGGTGGCGTGGCAGTTTGTGCCACGTATCCATCCCAGTCGAAGGTTTGCAGCCAGTCGTGCTTCTTGAT
TTCTATAATGCCATCAGGACCTGCACCAAGTCGCTCGGACTCCATTGGATGCAACAAGCCTCGCAGAAAGGAGCGACAGCTCTGTGACAGCTTGGCATTG
GACCCAGACGTGCTGTCCAAAAGTTCTATCGGGTAGTACCTGTCGAATACACTCTCTGAGAACTCCTTGATGACGTCAGGG