Description :
From Genome Similarity Track
Location :
Scaffold_165:29292- 30605
Sequence
1313 bases(100 bases per row)
GGCACATTTCCATGGAGCTGGCTAGCGTCGTTGCAGAATACAAGGTGCACCTTGCGGATCTGGCTGAGATCCTCGTTGAGGCCATCGAGATGGTATGGTG
TCCGTTTCGAACCTATGAGGTAGTATCGGCTTCACTGATGGTTGTGTGTTCTATGCGGTGACATCATCAGATCGCCAAGCACTTGTGCACACCCACGGCG
AGCAAAGACGCAGGCAGATCACGAATTTCTGCAGTAAGTTGCTTAAGCTTGGACCCTTTGCATGCACCAATCTCATGTTGCTCCTGTTGTCCATGCGTAG
AGAGAGTTTATCGAGAGGCTCGTGCAACACTTACTGGAACCCCTGGGGCAGCGTATGCTGGCAGAGCCTTCAGCGTCTTACATCGACTTGTTCCCCCGAC
TTCTTGAACAGTGCATCACTGTGACGATTGAGTACGGTCCCAGCTTGTGAAGTTCTGGTTTTCTGTGCCTCGCTAACACTATGACCATCTTAGCAACTTC
GCACGCAGCAACGGGAATCAAAATGAGTTGCAAGCGGCTCCATTTGAAGCTGGCGTGATGCATCTGCGCACCTGGACTTTTAAACTCGAAATTGAGTACA
ATACGCTCCTGAGATCtatgagcagcagcaacaacacagATTTGAGCACGGATACAGACACGAGCGATTATGCAGCCTTGAACGCCACATACGACACGAA
CAACCGCATGGACCTGATGACGCTCGGGGGATTCAAGCGGCTTGAAACTACATTGAGCTCGTGGCTgaatgctgctgcatcatcaaCTACGGGTGGGCTA
GACTTAGGAAGCGGCACTTCAGCGCGGTCGTGGGGTGTTTCTAGTCTCGCTGGTGGCATTCGAAGCACATTAGTACGGACCTTCTCCGGTAGAGCAACGT
TCGGCGGTCCAGCGTAGATAGATTAAAAAAATGTTTTGTTCTCCACACTCCAAGCTATCGAACCACCACGGCATTGATCTTCCAGAGCGTCAGTCTGTCG
TGCTTGAAACAGTGAGACATCGTCAATGCAAAGCTCATTAACAACAGCCGGAGCAGATCTTCATTATCGGTTCTCATATCCGCAGGTGAGGCAGAGATAC
ACATTCGGCACTGGCGGCATATGGCACCAAACAAGCAATCTAGATGCCCACTGCGTAGCCATGGCATTCAACGCACCTGGCGATAATAACGGTCAGATTT
TGCAGCTCGGCTCGATCAGTAGGGTTCCAGTTTACAGCTAATGAAGTTGCGGAAGTGTGAACGGATGTTGATATGAAGTTTCTGTCGTCCCAATCTAGCA
AGGCGGTGACACA