Description :
From Genome Similarity Track
Location :
Scaffold_3:292917- 300538
Sequence
7621 bases(100 bases per row)
CTGCATAGCTTCGAACCGATTATGGCTCGTCTGCTTGCGCTCAAACTCTCGAAGGAGTGCTCCACAATTCGAATCAAGTTCATCCACCCAGGTGGAGTCT
TTGTACCCCTTCCAACGAACGAGAAACTCTCGTTGCTGTCGCCCATACCGTGTTTTCTTACCAGTGCGGCTCTCTAAAATTTCCTCGGCCTCTTATTTAC
CCTCTTCCAATTCTCGTACCCAACTGTCTTCCGGCAGTAGGCATTCGTCAAAATCAACCTGCTCTGCTTGGTCCACTGCTAACTCGTTGTCTGGTCGATC
AGGGAATTTCCTGACCCGCTTGAGTTTGGATATGTGTACAATCGGGAACAAACGGTATCCCGTTCCCTGGGTTTCCAGACGTGCGACATGGTCTCCTACC
AACTCCAGAACGCGGAAAGGTCCGTGCCAAAGATGAGCTAATTTCCTGGCATATCCTTCTTTTACTCGGTCGAGATAGGACCATACTTGGATTCCCTGTC
GAATCTTGTGGTTGACCACCCCTTCGTTCTGCAATTGCACTCGCATCTGACTCGCATCTCGCAACTTCTCCTGTCTCTTGCTCGCTGGTACTGGCTTTGA
ATGCGGTGCCTCCACCTTCCGGGTTCTGACTCCTGACGCCGGACGTTCATTATCGGTAGTGTGGCTTCAAAGGTGGATCTGGCATCCCAACCGTGGACCA
AATAAAAAGGCGTTTCTTTTCGTACCCGGTCCTGTGAGGTATTGATCGCAAACGTCAATCTCTCTGCGTACTCGTCTCAGTCCCGTTGCCCTACGTCCGC
AATATACTACTTGATAGATCTGGTAAGAGTCTGGACCATCCTTTCCGCCGTACCATTAGCTTGGGGTCGGTAGGCCATTGTCGCTAATTGACGTTGAACC
ACCATACTGTAAAACGCTCGGAAGAAGTCCAACATGAATCCCGGTTCTCGATCGTGACGGGTCGCCTCACTAGCCCCAAAACGACGGAAAACACACCCTT
CATATCCTTCAGCGACAGCCTGAGCTGCCCGCGACTCGCTAGCCTTGGTCATTACATATCCGGTGAAAAAGTCAACCCATATCAGAAGTTCCGTATTTCC
TTTATACGACTTAATCAGGGACGGGATATGGTCCATCTTTATAACTTGGAAAGGATGAGTCGCTTCGATGTTCCCATGGCTCTTCCCTTTTAGGATAGAT
CCCCCTTTTTCAGTCTCACATCCCATGCAAAAACCAACGTATCTCTATGCACTCCAAAACAGACCTTTGTTAGTGACAGTAACGTCGTATGCGTTGGTAT
GTAGGCCCGATTTCTTGATGAACTCCTTCTAAACTAGTATGGTAGTGGTGGAGGAAGTCGGTCTGGAGGCTTTCCGGTATCACCAGTCGGACCGTTATGT
CACGGTCTTCTCCCTTGACCCTAGGGTTTGAACAATATACCAGCAATCTTTCCTCGCTTACATCGCAATCCCCGTACATTTTGCCGCACTTTTTAGCGGA
TTTCACCAACAGGTCATTCCAGTCTCCTTTCAGATATGCATTCAAATCTCGTACCCAGATCTCCTCTTCTTTCGCCTTTCTAATTCGGTCCACGCGGAGT
CGCTGTACTACCTCCTCTTGCATGATCTCTCCGGATATCCTAATAGGAGACCGTGACCGAATTACCGCAAATATTTTGGTCGAGAGGTTCTGGTCTTTAA
GAATTAGCAGCTCCGGTAGACGATTGATCGCTTCCAAACCTGGTCTTTCTTCGCCCGGTACCGAACTGGTTCCCCCTTTTTGTTGCAAGGCGGTACTAGC
TAACTGATCTGCGCTCTGGTTCCTATCTCGTTTCACATGCAGGATTCCGTGCAAAGGCCACGATTAGAGTTCGTTTAAAGCCCGGGCTCGTAGCGGTGAT
ATACCCGAGGCCTTACATTAAATTTCACCTCGCATCTGCCGCACTACTAAGTTGGAATCAATCGTCGCCGCTCCAAAGGTTTCAACAAGCTAATATTAGC
AACATACCCTCATATTCCGCCTCATTTACAGTAGATGTATCGATATATTTGGAGGCGGCTTCGACTATGGTCCAATTCGAAAGTCTCCATACGATAGAGC
TACAAGCCCCACCTCCTTGCTTGACACGGACTGACCCATCGAAACTCATTACGTATAGTTCTTCGTCTGATTCCACGGTAGGGGTGGGTAGGTCGATTGT
TTGCCTCTCCTGCTTCTCTTAGGAGAAATTGCCGACAGTATTGAGTCTATACTCTCTCGAGGGGTGACACTGGCTGCCAACGCCCCCAGCACCTGATCTT
CACCTTTTTACACTTCACGATCTCCAAAGTACACTGAGACAAGTGAGCGGGCCAGTTTCCCAATCTCCCCTGCAAGCCGGTAGACTTTACCGACCATGCA
ATGTCGAGTGTCTTGTCAAGACTTTGAGAGGCCGAGTGACTAGCATAGTGAAACAGGTCTCCAGTATACGCAATAGGGTCAATACCTCATTCTCCACTGT
ACTGTAATTTAGTTCGTTAGCCTTGAGGGTTCTGCGTGTAAAGGTTACCGGCATAAGCCGTCCTTTATAATTCTGTACCAGTGACGCCGAAATGGCCCAT
TCACTCGCATAGACAATAATCACGGCTTCTCTGGTTGGGTCGAAGTGTCTCAGAATTGGCGCCGTGGAAATTTTATTCTTGAGCATGGCAAAGGCTACTT
GAACGCGGGCCCGCCTTTCTTTATTGTCATCCTGGAAATTGGTATTATTATGTCCCTTCAACTGGTTTCGTCGGGTATGAAAGTCTACTTCTCCCAATTC
ATAGAGGATAGATGCATACACGGCGTAGTCCTCAATAAACCTGCTATATTAATTCAAGCTTTCCAGGAAAGATTTCATGGCGTTCAGTGTCATTGGTAGG
GGTAGGTCGACCAGAGATTAGAGGTCTTTCGGGTGAGCCTCTAGTCCTCCCTGGATACCCGATGTCCAAGGTAGTCTACCGTTCGACATCCCCACGAGCT
CTTGACTGCGTTGATTATTAAATTTCGGTAGTCGTACACATCTAACAACCATTCCACCTCTGTGCATAACGCATCCCACGATTCTGCGGGGATCAGAACG
TCATATATATATGACCGCCGGCCCAGGATCGAGGGAATCGACTACTCATCTGCTCTCCCACCTTGAACAAATTATCGGACCCATCTGTATCCGTTTCTGG
AGGGATTCGTAAAACCCCGTATAAAGCGTTACCCACGAGTCGTTGATATATTTGAGGCGCGTTCTTGAGCCCAAACGGCATTCGCATCCATTCAAACAAA
CCCAGTGGGGTAATGAACGCCGAAATTCGTTTCGCCCTTTCAGTCATACCGACCACCCATAAATCCTCGCCATATTCAATGAGAAATACCATAATGCCTT
GTCGAAATCTTCCAGTAATTCATTAATCAGAGGCATGGGGTAGACCATTAGCTGAGTCAGGTCGTTCACCAACCTGTAGTCGATAGCATAGTAATAACGA
TTGGGATGGCCCAAGGTGACGTAGAAGGCTGTATAATCTTTGTAGATAACAGTCTTTGATCAGATCTGCCAACTTCTCCTTAAATTGGGGAGCCACTTTG
CGTACGCTTTGCGTGATCGGCTTTGCATTTCCTACATCAATGTCACATATAGCCCCTCGAGCTGCTGGCGGTTAGGCATTCCCTTTTTCCATCAACAGAT
GTCGTCTATTCCAAATGATTTGTCGTAGCCAGTCCACCTCTTCTGGAGTGTTCCCATCCGGATCAGGGATCTGTATATATTTCAACTCAATAGATTCGGA
GGAGGGGTCCACTTCTGGTATGATTGCCCACCCTTGGTTTATGTCTTCGGCCCACAGGTCTCCGCTTTCGAATGTACGCACTTGTTCGTCGTCACGTGGC
GACTTGTTGGTCTCGGCTTCCTCTGCCTCGACTGAGATTGCTCCCGATGGATCGTATTTGTGGTCACTTCGTACTTGAGGGGTCTCTTCTTTGCGTGACT
ATTCTTCTCTCGGGTAGCCGCTGGTGTGACACGTTCTTCATTGAGACGTTTTGACCGCTTCGAGAGCCTACCGAGACGAAACCTCGTGCTCTTGGTACTT
GATCCTTCGTCAGCCACATACCTATCTTGGTATAATCATGTAATATCAGCGTGTAAGGGCTAACGTTGGTCACCTTCAGCAATTGTCGACGTCCTTTTCC
CCGGGCCATAGTCGTAACCCATCGCTCTCCTCTTGTGACCCATATCCTCCGTAGATCTGAGATCGACCTTTAAGGGGTACCTCCACAATCCACCGGCAAG
TATACGGGCATATTGTTCCAACTTCACGTCCGCGACTCGGTTATCGTAAACGGTCCTTCGTCCGGAGAGTTGTATCCGGACTTCGTTAGGGAGACAGAGT
GTTCCATCCGCCAGATCTAGCCGGATCCCAGCCGGGACCATAAATCCATTCCAAAGATTGCATCCTGACCCACCATAGGGCCTACCCACACCTTGAACAC
ATTCACTAAATTTACATTTAGGGTGACCTTGATGGGAGTACGCCCTTCCGTAGAGTACACCGATTCCCCGAAGCCATGGCACTTTTGTCGTTCGCTTTCA
TCGATTTGGCAGCCTACCTTACATGCAAAGGCGACATCCAAAATGGATATCTCGGCGCCAGTATCGAACAACAAATTTGCGCGATCGTTGTTAATCTTCC
CAGAGGCTTTGGCTTGTTTAAAACACTTAGTTGTGGCGTGGTATATCCAGTATCCTCGGGACTGTCCAGGCAATAGGTCTAACTCCATCACTGCATTTTC
CCGGGCGAAATCATTAGGTTCATTGAGAGAGACAACATGGACCATGGGATATTTTCGAATCTTCGATACATTATCGGTCTTCTCAATGGAAACCCCCCTC
TCCTTCTCGGGCTGCTTTTCCACATATGCAAAGATACAAAAACTAGATCGCTCGACTCGTACCAGATTCAAACTTGGCGAGCGTTCTAATTTACCATCTT
CTCCGCTTTCTCGGGCAACATTCCGGCGTGCTTGATGGGGTTGTAACATTGACGAATCAAATTGTAGAAGTCCTCTAGGTGGCACTTCCCCGCTTCATGA
GTCTCTCCGCACCCCCCACACACGAACAAGCAGCGATCCGATGGATGTCCCTTCTTTCCGCAGTGGTCACAGGTCATTCATTCTCTTCCAGTATCTCAAG
TCTCCATGTTTCCTGGACCCACAGTGGGTGCATCGTACGTTTGACTCGGCCGACGCGTTGCGGGTTCCAGGGTCTTCTGATTGTTTCTGATGTTGGTCGA
CCTCTCTTGGGGGCCGATCCCTCGCGGTTTTTGGACTTGGGTCCCTTTCCGCTTCTGCTAAGTAGATCCGTCTCAGTTCTCCCTCGTTATCCGAATTATT
CAGGCTTGATCCCTCCTAACTCGACTTTTCTAGTGTCGCTCAGACTGCATGCACAGAACGGCGGTTTACATATCTAGGTCGATCTGGAGGTGCAGGTACC
TTCTACCGGAACTTGCTGGAACTAAATAGCGTCTTGCCACGCCGTGCGTTAGTCTTCTAGCGCGCCTTTAATACTTCCTTCAATTCTTCCACGTCTGCCA
GGAGTGGCATCGTCAATCGATCTGCCAGCTATGGGTCTTCTACGGTCTCGATGTAATGCTCGACGTGTTCCTTCTGGAGCTTGGGTGATCCATTTTTGAT
CTTCAGCTTCACCCTAAATGCAATCACATTCAGGCGGTATAGGTAGTCCAACGGGGATTCGTCTGACCTCTTATTCGCGTGGTAGTACAGACGGGCAACT
GGTACCCCCAGACCACAAAACTGCATCTGAAATTCTTGTAGCAGGTCCTTCCAATTTTATCTAATGGAGCGGCCCAATTGGCGGTGCCAGTTCTGCGCCA
GCCGATGATCAGCAGTCCTCCGAAGACCAGAAACTTTTCGCTGTCTGGTGCTTGGTCCCTTCCGAGGCTGGCTTCACTGTGTTTACCCAACCGAGAGCTC
GGTCCTCGTCCAGGTCTCTTTGAGGTCCAAAGTTGTAGAGAGCCTGATGAGAGGAGCCATGCTGAGTCCCTGTCCCATCGTATTATTTTCCATCCTCGCC
GGAGTTTCCTCCAGGTCCAGATCATCCGGGTCTTATTTGCACGAGCCGACCGATTCCATGTCGACGTCCGACATTGTGGGTTGTCTTTGGGCTTGGACCT
CTTCCCTCAGACCATTTCTAATAGTCGCCGGTCGTTCTTCCTGTCTCTCTCCGGCCTCTTCTCGATTAGGGCTTGTTGATGGCGCTTCCCTCCAGCATCT
TTGACACGTGGCGGTGCTAAGGTTTTGGGATGATTTGGTAGGTTCGTTATTGGGCGAATTGTGGCCTATCAGGAGTCCGCATTTCCGTTGGCTTTCAACA
CGTCGCCCCGTCGTAAGTAGGCTGTTCCGCCGGCGTATCTCGCGCGCGGGCCTGAAGTAACGCGGCTCCGGTAGGCCCCAGTGACATTCAGGCGACGTGG
CTGGACGTTGAGGATCGTTGTGACGAGTACCCTGCTGAGACTTGGGAACATGAAGACTGTGTTCCGCGAGATGGTGGTTCAGTCGATCGTGGGTCCCAGT
TCACTGCTTTTATTGGGGAGTGAACCTCAATATCCTGGAGATCCATTTGACTGTTTCTATTAGGTTCGTACAAGTCTGCGACTGGAGACAAGGTGGGTCC
CGTGGGGTGTATCCCGACAAGAATCCCCAAACATTTGTGCAGTTTTCCTAACGTTGTAGTGATGCTGTCGAACCCCAGGGCAAACACGTCGTTCGGTTCG
AACCTCTCTGCGGTCATGCCTGCTTCTCGAAGGAGAGTCACTAGCGCGGTAATTGCGTCTGTGATCGTCCGTATATATGGAAGGGGCGACAGTGGTCCTC
ACAGCTGTCCAAGTAGCCGGATCTCGAGAGATGTCGTCACCGGGTCGGTGGTCAGGAACGTGTCGAACTTACATCGGTGGTAGGCCACCGTTATGTCAGC
GTCCGACCAGATTAAGGGCTCTGAGCGTTCAGGGTAGGCAGTCTTGGTGTCTGGACTTGATTGGTCCAGGACCAGCCGACTTGGTATTGCCGGGGGCCTT
CATTTTGAACTTTTTCGTATTGGACGTTGCGATTGTTGTTGTTTTTTGTTGTTGTTTCGGGGACTTTAGCATCTCGACTTTGCCGTCTGCTGTTGGACCT
CTGGGGCATGATAGGTATCATGACCCAAGGTGTCCTCTACGAGGACAAACGGAGGGTATTTAGTTTTCTAATAGATAAGTTCGACCCTGACCTTGTTGAC
CAGACCCCTTCCAAGAACGGTCGATCCTTCGATCCCTTGTCTTTTTCTTCTTTAGTCACTGACGGTCGGTCCTCCAGTGAAGATTCGGTCTTTTCCTCAA
TCTTGAATTGAGCTTCTTCGTCCCCTTGGGACTCACGGTGAAATCCCGCGTCTTCCGAAGATCCTGGCACGCACACCATTTTGGTGAAATGGGTTCTCAA
AACTGTGTGTTGAGCCCCCAAAACACTCACTGCGCCGGACTGACGACTTACAGGGGGGGTACCCCGATTCCGCGTATGGACCTCACCTTGTGTACCCGTC
GGCTGGCGGGTTGCACTCTTC