Description :
From Genome Similarity Track
Location :
Scaffold_66:292905- 294895
Transcript NameFunction/comments
Physo_138765hypothetical protein

Sequence
1990 bases(100 bases per row)
GTCGCACGACGAAGTCGCCATGGCCGACGCTGGGGTCGTGGCCGAGAAGTCGCCGAGCGACGCGGGCTCCAAGCCCAAGGAGGTGCTGGCATCCAAGCAT
CTGACGCTGGCACAAGGTCGTGAGCGTGCCCAAGCGTCGAAAGCGGCTGCCGCTGCGAAGGCCGCCGAGACCAAGGCGAAGAAGCGTTCAGCTTCCAGGT
CGCCTCGCGGCTCCAGCTCCAAGCTGTTCATCGACTCGGAGTCTGAGGACGGGGAGGGTGCCGTCCACGAGCCCAAGGAGCTCTCCAACAACCTCGACGA
GCAGCAGCAGCAATATCACGCTGCTAGCTCGGGTGCGTATGCCAGGCAGCCGACTGCCACGACTACCATCGAGTCTTCTTCAGGCGGGGATCCCACGTAC
CCGCAGGGCTACTTCCCGCCCGAGCCTGGCACTGGTGCGCCAGCGCTGTTGGAGAAGCTCTCGGTTCCTCGTGGCCTTATCGGCGGGTACACCTCGAGGG
GTTCCTATGAGCGTGCTCTTGTTGAGAAAGAGCCACTCTTTCTTAGCGACGTTGAAGTCGCCCGGTGTGTGCTACTAGCACCACACAAGCTCACACTGAA
GGAGTTCACCACGCTTCGCAAGAAGCCGGAGGACAAGGGTGGACTCCATCCTGTGTGGGGTTTCCACTGGGTCAAGCCGAATGACAACATGACCTGGAGC
GAGGTGGAAGACCTCTTCTGGCGCTACGTCCAGCGCAAAGGGTATTCCGACCAAGAGTTCAAAGAACTCCGTGAGGATCGCACTCTGTCCGCAATCCTGG
ACGTGCGCGAGCTCCGCATCGAGTTCGCTCAACTCGTGAGCAAGCGCAAGCTCCACTCGAAGATGGACGAGCTGAAGCAAGAGGCTAGAGCCAAGCTCGT
GAAGAGCGTGGGCGTGGTGCGACTACGTCTGCTACCGTGCCCCGGGTACCGGCCAAGAAGCCAATGACTACTTACGAAGCTGCCGCTGCTTCTCGTCCCA
TATCGCAACAGCCTTCGCGCAGTCTGCCTGGAGCTGCTCAACGGGCTCCCACGAGTTATCCGACTCAGGGTAACCCCTCCACTTCACGAGCAGCTGGCGC
TTGCCATGGAGCCGCCGCTCCCGGACGACTCGTTCCACGTGGTAGTAGACCTGCCCATTACGATCAAGGAGGGCCGGGGGTGGCCTCGCACGGCCATGGC
TACGAGCCTGAGGCGACGCAGCCGTATGCTGGGGCCCCGAGTCAGGTGGTGGCCCTGCAGCAAGAGAAGATTCGTCTTCTCCGGGACCGTGTGTACGTCC
TCGAGATCGCGCTTGGCGTCGCCCTTGGTGGCGAGGCTGCCGCTCGTGCTGGTCAGCCTGGTGCCGTGGAGCGGCTCCGTGAGGATGTTGCCTCGCTCTA
TCAAGAAACTCGCAGTCTCCATGGCCGTGTGGATCGTCGAGCCGACCTGTCGTCTTACGACTCGCTGCGAAACCAGCTCGCTGGTCTTCGGGCCGAGCTT
CATGGCCACGCGCCGTCTCCGGAGCAGCAGCAGCCCCACTCGTATCAGGCCCAGTTTGGCCAGGGCTCGTACGGGGCCCCTGCGTATGCTGCTCCGATGT
ACGCCGCGCCGTCTTACGACCAGCGCGCGTATCAGGCGCCTTACCGCGACCCGACGCCGCGCTTCGAGGAGCTGCGCTCTTCTCCACCGGGCCACCCACC
GCTTCCTGCGGGGTAGCCAGAGCCAGAGGGTCATGGTACCTCTTAAGACGACCCACGTAAAACGTCGGGTGAGTCGTCATAGACTTGGGCAAGTCTATGG
TGTACGCCGCGCCATGCCGGCTGAGGACCGTGAAGGGTCCAATGAAGCGGTGCTTCATCTTGTTGCTCTCGACCGAGCTAACAGTGTTTAGCGGTAGGTT
TCTAGTATCTAGGAGAACTAAATCCCCAACCTTAAACACGTTCATGTTTCCTCTTCCATTTCGGTCAGAGTACTCCTTCTGTTTATCTTG