Description :
From Genome Similarity Track
Location :
Scaffold_425:29290- 30755
Transcript NameFunction/comments
Phypl_g8187hypothetical protein PHYSODRAFT_473661
Phypl_g8188conserved hypothetical protein

Sequence
1465 bases(100 bases per row)
TTAACTAACATTAAGCTTCGAGGTGAGCTCCAGTTTCCCACCTTGACTCGATCGCGGGACCCACAGGAGCAGAGATCCACCTCCCGTACCTGGAATACCT
AAGAACCCAGCACGCCACCGATCCAGGTAGAGCGTCTTGCCTCCTAGCACTGTCATATTGGAGACCCAAGTCACGTTGGTGCCGGCATCAACTTTAACCT
GGTCGATCTCGTTGCCCCCTGACATGATGTTCACCGTCACGCTTTCAGTATCTTCGCTGTGGAAGGTGATGATGACAGTGCCGTCGCCGTTCTTGGTCCA
AGTTCCAGTACTGTTGTTGAAGGCTTTGCCCACTGTCGTGAGTCCTAAGGCGTCAGACGCAGAGCCATCGTCGACTTCGCCGATGAACTCCGTCGGTCCG
CAGATGCTCTGAAAAAATTTGGAAACCACGGTAGCGACGTTCGAGGGGTCCCAAACTGCCGCGAGCATGATAACTTTGTCGCTAATGGTGTAGGCGTACT
CTTCAGCTGAGAGATAAGTGTCGTTCTCACTCGTTCCGGAGCGGATgaggtcgtccacgatgcCCCCGAAGGTTTTGCGCAGAGTATCTCGCGTCGTGTA
CGCAGTCGCCTCGTCGGATTCCTCGATCAATTGCGccatgcagttgttggtggCGATAGGGATCTCATGGTGCATGAGGTTCGACTTGGTCATGATCACG
CGGATTTCGTCTTCGGGTTCTCCTTGCGCAGGTACGCCACCGTCAGCCACACGCGGTCCGTAAGTCGCTTCATGTCTCCTCAGGTCGAATCGGACTCCAG
TGCCGACTGCAGGGATGAAATATCCTTCTCGTCGAGGTTATCCAAGGCTTCATCCAGAGTAATGTTCTTCATAAAGGCCGTGAATGACTCTCAGCTGGAC
GTGATGGCCGCCTGGTTGGTCACGACTTCTTTCACGAACAGCTCGACGGTGTTGGTTACTCGGTCGGCCACCTTTATTCCCTGCGAAACTTTGATCCCGA
GACACGACATGACAGTGATCGGCACGTCAAAGACCACGTTATCGGTCTGGTACAGCATCGTCACGAGCTggtccgtcgtcgtctgcgggTCGTTCACTTG
AACCGTCCGCACGTACTTTGAGAGCGCCTTGACCAAGTTTGCCACCTCCTTGACACACCGGAACGCCGTCTTGACCCCCTTCGCCATCTTGGAGAACGCA
CCGTACGCCCCGAACGTGGCGACTGACAGCGCTGATTGCGCTACTGCAGAGACCTTGGACAGCATTTCAAGCGTGCAGTCATCGTTCTGCCGGATGCACT
GCATTCCGCACTCGACGGGGTATTCCAGAGGACACTCGCCCCAGCACGTGCCGAGTTTGTACTCGAAACCAAGAGCACACACTTGGGCCACGTGGGTTTC
GCGATAGCACGCCAtgtcgacgccagcgccagctccagagCCGACCCAGTTCGTGTACGTGGACT