Description :
From Genome Similarity Track
Location :
scaffold_83:29281- 31332
Transcript NameFunction/comments
g3061.t1hypothetical protein

Sequence
2051 bases(100 bases per row)
AACTCGCTAGTGTCCGAGATCGAAATTGAGGATGTACTTGAGGCAGCGGAGGCTGTGCGTCAGGCGTACCATGACTCGACGTGGGAGTATGTCAAGATCG
TCACTATGCTGCTGCTTTTCCTAAGCGCTTCAGATGTCGAATCTTTGGCTTCGATTAAGAGCCGATCTCCTGTCTCCTCTGGGCTCAGTCGACTTGTGAA
GGTCTTCTATCCGTATCTGGTGAATCAGCCTCGGGAAGAACTCAGTGAAAATTGGCATCCAGTGAGTAGCCTCCTGGTAGCGATGGGACTGCCTGTAGAT
CACCTGTACGTCTTCTTGGACCCAGTGTGCAAGACGCTTCTTCTGGCTGCGGAGTTGACCAGGCGATCGAATCAGGACTCACAGGATGAAGAAGAACTCG
CGGTCTTTCCCAAAGTTACAGTGGTCTGCGACCGAGACGATGTTCTTCAATCGAGTGTGGAGTACGTTTGGCGCACTCATCTCTCTTCTGAAACGATCCT
ATCGACCTTTTCTCTGTTCCCCTTCTTCAAAAGTTCATTCGGTGAAAAGGTTGTGGATGGAGTAAATGTCGAAGAGGGAGAAGGGAAGGGGCCATTGAAG
GAATGGTTTACGCTTGTAGGTACTCAGCTCACGTCCAAATGGAAGCAAATACCGGCATCCCGGGTTTTATCGGAGAACTCAACTCAAATTACTGCAAGTG
GGAACGCGATCACAATTCCAGGGGTTTCAGATGTTATTAATCCAGGGTTCCAGCTCGAATGGGAGACAACTGAAGGGGAAAAGATCCGACGAGTTATCAA
CAAGAGCGTGGAAGGCAACACTTTCCTACTGGACCGCACTGTGCTGCCCCATTCCTTCTCGACGTCTCAATTGTCTATATGGCAGCCTACCAGCGCAATT
TTCGACTATGTCCAAGGATCGGAGAGTTACTGGCTCAACGAAAACACCCGCGCGTCACCTGAGACCCGCAACTTGCTTGTGTTTGTAGGCTGGTTCCTGG
CTAGTGCTGTAACACACTTCAGCTCGATCCAAGTGAGGATACATCCGCTGCTCTTCCGCTTATTACTGAACCCTCAGCACTGCGTGAAGCTGGAAGAGTT
GCAGTCGTTTGACCCTCAATTATTCCAGTCGTTATCCGGAATGAAAGACATGAAGGCGTCGGATTTTGCAGAGTACTTGAAGTTCGAAGGGGCCGACGAG
AGTTTGAGCGTTGGGGAATACGTAGACAAAGTGCTTCAAGAGAAGTTCGGTCCTGCGTCTGGGATCGGGTGGCAGCTCCAGGCTCTTCGACGCGGGTTTG
GTCGTGTCATTGCTCTTGATCAGCTTTCACGCGTCGGAATTACCGAGGTGGAGCTGGTAGAAAGCGTTTGCGGAAGTAGCGCTGGACCTGGGGATGATTT
TGTCGTCAATGAAGTTTTCCGTGTCGCTGCCGACGCGGACTTCACGGCCTGCGGACCATTAATGAATGCGTTCTGGCAGACAGTGAACACCTTCGAGCCG
CAACTGAAGCGCAAGTTTATCAAGTTTGTGACGGGGGTAGATACTCTACCACTGGCAGGAACTGAGGTACATTTATGGATTTCTTTGTCTTTTTGCATTG
AGCTGCGATTGACTGACTTTGGTCGTGCTGTTTAACCTTCAGTTCCTACGAATTGAGATGCCATTCACCGAGATTTCTGCGGCCGACCACGGAAAGTGCT
TGCAGATGCTCCCACAAGCTCATGTACGTGGTTTTAGTGGGTTTCTCCAGCTGCTGCTTGACTCACGGACGTTTCTCGGTTTCAGACGTGTGATAACACG
CTAGAACTACCTCACTACTGGAAGGCGCTTTGCTGGAGAGAGCAGCACGATGAGCACGAAGCGAATTTGAAACTGGAAGAAGAGCTGGCGCTTTTGCTGG
GGAAGAAACTTCAAGATGCAGTGGAGTACTCGAGCGGATACGGACTGGATGGCACGTCTGAAGTTGCTGGAGTGCTTGGTGACAAGGCGAAAGATGATGA
AGATGCGATGGCAAAAGTGGGGGAGAGTTACGACTCGTTGGGTCTCCCCGC