Description :
From Genome Similarity Track
Location :
Scaffold_789:2928- 6302
Sequence
3374 bases(100 bases per row)
GGAAGAATTTGTGATGGTTTGCCCAGTGGTGAAGGCagtgcagctgaaggaaCCGCTGGAGTGTCAAGGCGCTGACGGGAACCTATTGAAGTGAAATCGA
TTGTGAGCCTAGATTTGAGACTACGGACTGCTGCCGGCAGCGTTTGAATTGCAACGCCAGTTGAGTGCCTTATCATTCCTGGTGATGCAGACGAATTTCT
GTTGGTAAATGATGTGTTGACGATGTTGGGTATTGACGTACAGCggcaactggaacttctcgttgctggagctgtacgTAATGAAGTGGATGATGAATTT
GATGATGTTGATGCGCCACGAATTGGTAGCAGCGTGGAATTGAGCGATGAATTGCTAGCAGTATTGGAGAAACTGGTGGAGAAAGCACAGACGAATGGCT
TTCCTGTCGAGAGTGTCTCAGAGCTGCGCCGAATTGCTGCTCGCTTCGACATTTGAAGACTGAAGCTGGGGGGCGATCCGCCCGCACGGGCCCCGCCTAT
TAAAGCTCGGTTTCGGGACGGAGCCAAGCCTTACCGCTGTAAAGCGCGACGGTATCCGCCTGAGGTGCGTAAATTTATGGACGACTTCAACAACGAATTA
GCCCGGTTAGGTTGGGTCTACGACAATACTGAGAGCCGGTGGGCGTATCCTGTCTTACCAGGACGTTCGAGTGGTGGGGAATACCGGCAAACCGCCGACT
ACAAGCCAGTAAATGCAGACATCGAAACAATTGTCGGTGTAACGCCTGACCTGCGCGTAGACctggaagaagtccaagGGGCCAAGTTCTTCGGTCTATT
TGATTTTATTAAGGGCTCCTGGTAGCTAGTGCTAGGCGAAGAATTACAGGAGTGACTATCATACATGACACACCGGAAAGTTTACACACCTCGCAGAGTG
CCTCAAGGATGCACAGACGCTGTACTTTTCTTCCAGTCGACGATTCAGAAGTGTCTAGAAGAACTGCTGCACAAGATATTGCTCGTCTGGATTGATGGTC
TGTTGTTGTTTGCGGACGGTGTGGCTACGTATATCTCTAAGTTGGAGCGGTTGTTAGCATTGTTGGATTTCTTTGGGTTCACGAGCAGCCCCAAGAAGTC
AAGCCTGTTCAAACAAGAGGTTCGGTGGTGCGGTAAGCTAATTAATGGTGACGGGGTTCGCctgcaagctcttccttACCCGAAAACGGCAGGCGCAGCA
ACTTCTATGAGCGGCGAATTGAATGCGGGATTCGTTGGTCTACTACGCCCGCAAGGCACGGCCACTGCAAGATGCACTGGATCTCGCATTGGCACAAGCA
TCTAGGCGGACTaaacgagctgctgcagggaTTGCAGTTGAGCTTACTGAACCGGAGCGAGCTGCCTACGACCAAATGAAGGAAATGCTGGCCTCGAGCG
CCACACTGGCGTTCCCAAAGGGCGGGGCGACAATGTGCCAGCTTACCGATGCTTCGGATGTTGGCTGGAATGTTCTGGCTAGCCAAGGGACTGGCGATCA
GACAAGGGAGTTCACGAGCAGAAATATGAACTCTTGGTCTGTTTAAGTGGTAGCTTTACTGGATCGTAACGCAATTGGTCGGTGATAGAGAAGGAGGCCT
ACCCGATTGTGTGTGCATGCGAAAAGCTGAGCAATTTGCTTCTACGACCTGGCGGATTTCGGCTCTATTGCGATCACCGCAACCTGACCTATGTGTTTGC
GCCCGGCAAAgaagtgaaaaaaaaacacatTAAAGGCAAGTTACTAAGATGGTCAACAAAATTGATGGGGTATTGGTATGAAGTGGAGCATATTGACGGG
AACTCCAATGTGTGGGCTGACATGGTTTCTCGTTGGGCTGGGAACCATGACGCTACGGTACACCTGAATGCAATGGCCCTGAGAAAGCGAAGCCCGGCGG
AGCCGCAGCTAGAAACACAACAGCCGCGCAAACGAACGCGCCGACGGCGGAAGAACACCACACGGGTGGAGGACCGCCACCCACTCGCGCAGCACCTTCG
TCCTCTGGACGACCCCGATTTCGTGTGGCCTTCCGCCACGGCTATCCGAGAGACCCAGCGATTGCATGCGGACTGCAGGTCACGAGTGGCGATGGGCGAT
GAAGAACATGGCTGGTTCATTAAGGATAAAGTGTGGATTCCTCCCAAAGCAAGCGACCTCGTACAGCGGCTCCTAGTGGTGGCTCATTCTAGCCCCCAGT
GTCATCGTGGACGTGATGCAATGCTGGAGAGTGTTGATAGGCACTTCAATGTGCACCATCTGCGCGCACGAGCACGCAGTCCCTCGACACATGCCTCATG
TGTAAACATGTAAAAGGTGGGAACACTATCAACGACCATGGGGACCGACATATCGAACCAGCAAAAGGAATGGTGCGTTGCACTTTGACTTTTTGACTTT
GGGCGAAAGCTTTTCGGGCGACTGCTAACTACTAGTGCTGAAGGGCGGAGCTACGCACTTTACTGAACTTGTACCCTGCTCGTCTCCCACTAGCACTGTG
GTGGTCGAGGCGATACTCGCTTGGTACAGTATGTTTGGAGTGGCACCTGTGTGGATATCCGACCAAGGTTCGCGCTTCAAAGCTGAGATTGTAGCTGAAC
TTTGCCGGCGCCTGAAGCGCGTCATGAGTTTACTGTTGTATACTCACCGTGGATTAACGGCAGCGTGGAGTGCGCAAACCGGGGCATCATGCAACTCCTT
CGGGCGATGCGCTTGGGGTACAAGGTCGACACACACGACTGGACGTTCTTCGTGCCCGTGTTGCAGGCTAGTTTGAACCATACACCGGTTCCGCCACTGG
GCAATCGAGTCCCAGTGGAGCTGTTCTGTGGTTTGTCACTCCCATCGCCGCTGACAGTATGGCTGGACACTAAGCAAAAGGGAATTATGGAACTACCGGG
GCAACCTGAAGCCATCCAGACTTGGCTAGACAGCCTCCGGTGCAGTATCCATGAACTCCACAAGCCCATGGAGAGAGAACGTGCTCAGCGGACTATGCGA
AACCAACGGATGCAAAAATATGCTCGTCGCTCAAACGTCGACGTTGGCAACTACGTGTTACGGTCGAGAGTAGACCAAAACCACCACGACAAGTTACTTG
TTACCTGGGTGGGGCCCACAAAGTCACAAGGGCGGGCCCACACTCGCTTCATGTGCGATATTTGCTCACCGGGGATTCAACTGATGTACATCCCTAAATT
CCATGCTGACAAGTCACTGCTGGTCACTGAGGAGCTGCGGGACCATGTTGCCGCCCAAGGACTCGTGTTGGCGGTGGACAAACTGAAACGTTCGCGATGG
AAAGAGGACACAAAAGACTACGAAGTTTTAGTAGAGTGGAAAGGGCTGGAGTCGATTAAAGACTCACGGGAACC