Description :
From Genome Similarity Track
Location :
Scaffold_1941:2928- 5704
Transcript NameFunction/comments
Phypl_g14431hypothetical protein
Phypl_g14432hypothetical protein PHYSODRAFT_341850

Sequence
2776 bases(100 bases per row)
GTTGATGATGCGACAGCAGTGGACTAATCTCGACTTGCTATTGCACCCCTTTTTCCTCCATCTACTCACTGTGCACGACGTCGACATTTGGTAACCTGGC
GCGACTTCCCGCGCCGCGAACGTCGCTGATCCCACGTGACAGCTAGCCGAGCCGGTCGATCTGATCGAGGCCCGTCGCGAGGGTGACGCTGCGGACGCCT
GGCGCAACCAGCTCCGCGATCGTCCTCTGGAGCACCCAGCCTACCAGATCACCCGGCTCCGCAACAAGTTCAACCCGTAGCTCGGGTCGATCCCTGATCC
GTAATGCTGGTCCAGCCAGCGACGCTCTGTTTTCGACCTCTCGTCGATCGATCGCTGTACTTATGAAGGCGTCGTTCCTGCTTCACGTAATCTCTCCATA
ATCTCTTCTTCCTTCCATCATTCGTTACGTCCGTGGGGTCGTCGACTGCGTATACATATCTATCCACACAATATGAACTCCGTTCCTCCGATCCATGGCC
TTCCCGTGAATCCTTCTCCTAGTGCCTGATCGGAGTGACCAACTCACTTCGATCTCACTCCTCCTCGTGAGACTGCATCGCGCCAAATCGATTCTGATTA
GCGTGACCCCGCAGGAACTCATGTAAGAGTGCCTCACAGTTGAGATCAGCCTCGCCAACCCAACTGGGCTCTGTGTACCCCTTCCAGTGCACCAGGAACT
CTCGGTAGGTCCTACCGTATCGCGTCCTCTGATCCTTCCGCATATCGGTGATCCGTTTTATCTGTCCTCTGGCAATAGGATCTCGTCAAAATCCAGCCGA
TCTGCCTCCGGTACAGTTAACTCGATCTGTGGTTCATCTGGGAACTCCCGGACCGACTTCAGTTTAGGGAAGAGTCGGTACTCCGTCCCGGCGATCTCGA
GTCGCATGGAATACTCATTGACCTTCTCTACGACGCGAAAAGGCCAGTACCACAGATGTGCCAGCTTACGCGCGTATCCCTCTTTCACTCGATCCAAGTA
CAGCCAGACTTGTGATCCGGCCTCGATCCGATGTGGATCGACGTCATCATTATGTAGATCGGCCCGATCTGCGATCATcatgcgcagcttggcgttgacC
TGTGCCCTCGCCTGGATGTAATAGCGCTGGATCTGGTATCTCCATCTCCTAGGGTCCCGATCTCGCGTCCGTGTACTACCCAGTGGCATGGTTGTTTCCA
ACATCGATCTCGGATCCCATCCATGTACCAAATAGAAAGGCGTATCTCTGCGGATCCGATCTTGAGCCGTATTGAGAGCGAACGTCAGTCTCTCGGCATA
CTCGTCCCAATCTCGCTAATCCAGATCCTGTACATACATTTTCAATGCGCTCGTTGTCGTCTACACCATTCGTTCGGCCGTTCCGTTCGCTTGTGGCCGA
TAAGCCATCGTCGCCCTCTGACGTTGACCGAGGATATTATTAAAGGCACGGAAGAAGTCGGACATGGACCCTGGCTCCCGATCGTGTCGGATCGCCTCGC
TGGCTCCAAATCTCCGGAAGACGCATTCTTCGTAGGATTCGGCGATCGTCTGAGCCGTTCGGGACGCGCTCGCCTTTGCGATCACGTACCCGGTAAAGAG
ATCTACCCATATCAACAACTCAGTGTTGCCCTTATACGACTTCGGGAGAGATGGTATGTGATCCATCGCGATGATCTGGAAAGGATACGTCGCCTGAAGG
TTCCCGGGCGATTCTCCCCTGATCGTAGGTCGGCCCTTGCCCGTCTCGCAATCCACACACTCACCAACATATCTATGCACGCTTTAAAACAGACCCTTCC
AATGGAACTGTTCTCGGATCCGCTGATAAGTGGGGCCGATCCCTTGATGACCGCCTTCGATACTCGTGTGATAATGATGCAGGGTATCTTGGCGGAGCGT
CTCTGGAGCGACTAGCCTCATCAACCCGTCCTGATCGGTCTCCGGTCGTTTGTTAGGGGGGCAGTAAAACAACAGATCGTGGTCATCTACTTCGTAGTCT
GCGGCCATTTTCCCATATGATCTAGCTTGATCCTGGGTGAAATCCGTCACATCACCAGCGAGATACTTCTTCATGCCTGAGATCCAGCTTtcctcgtcct
gcgcctGTCGGATCCGCTCGATCCGAAGGTCTCGGACCAACTCCTCGTTTAGCACAGGTGGGTCAGATCGGGGTCGAGCGGCTGATCGGGGAGTCACCGG
CGAGACTCGTACCACTGCATACTCCGATCGGGTGACTAGGATCTCGCCTAACCGATTCAGGGTGATCAGATCCGGGTACTCTTCCTTGCTCTCCACCATC
ACACCTTGCTGCCACTGGAGGGCTGCGTCGGCTAGACTGTCCGCACTACCATTCCAATTCCGTTTGACATGCAATATCTCGTGATTGGGCCAGGCACGTA
GTCGATCGAGGGCTTTCTGTCTCAACAGAGTCAAGCCAGGTGTCTTGCAATCGACCTCACCTCGGACTTGCCGGACTACTAGATTCGAGTCGGCACAGAT
TACCAGACGTCCATGATCCATTCCATCCAGCAGTTCAAAAGATAGCAGGAGACCGTTGTACTCCACTTCGTTCACAGTCAGCCCTTCCGCATAGCCCGAT
CGGGCCTTCAAAACACTCCACTCGGGCAACTTCCACAAGATCGCGCTGtaggcgccgccgccgcgcttaACAGGGGCTGATCAGTCAAAGCTCACCACAA
ACAGCTCCTCGCCCGTCCCCACGGTCGGGATCGGAGCTTGGATCTTACGTCGTGGCTCCTTTTTGGGTGCGATCGC