Description :
From Genome Similarity Track
Location :
contig_58:29278- 34394
Transcript NameFunction/comments
g8829.t1hypothetical protein
g8830.t1hypothetical protein

Sequence
5116 bases(100 bases per row)
CTCAGCATCTCGATCATCACGACGTACACAACGGTCGCTTTCCTACGGGCAGCCCCTTCCTCATTCCCTACCAGTTCAAGCATCAACAACGTAATTTGGT
CGAAGAGGTTCAGGCGGTTTCCGAGGGCTTAATTAAGCCCGACTTTAATATCGGTGACGTTCAAGTCGTGGAGGAGTGTTCAGCTGGACGTTTACACCAC
GTGGCTCACAACACCGTCATGACGACAGTCTCTTCATTTAAAGATTCACATTTCGGATCGGTTGGGTAGAAAACAACGTACATTCCTCCGTATATGAAGT
GAAGCAAACACCAGTAGGTACATGTATTGGCAATACTGAAGTATTACGTGGTCATTATCGGAAAATAGTATACTGCGGAGATCAAATGGCACGACAGTGC
CTCAATTAACTACGGCAAGCGGGAGCGAGCGCACGAAGGCGGACCCAGCGTCAAGCTTCACAACCAGCCCTGCATTGCTGTCGTCATCCACACTCGCGAG
CGGAGCATACCGCGGGAGCGCCCAGCCAAGCTGATTATCAACGATGTCATATGGTGTAGGTTTGGGCCATGTTATACACTTCGACCTCGCGTCATCCATT
TGCACAACGCTCTTGGTAAACAATTAGTTGTCCGTGGAAAGCAATACAAATTACTTCTCCAAGTACTCGCAAGGATGATGATGCGTCTGAGCTTCGTTGG
GCTGCTAGCTGTCGCACTCCTGGCCAGTACCGATACGGCCTCAGCGCAGAAGCAAGCGGAGGTTTTTCACCAGGATCCCCAGACCCTGTCACGTTCACTT
ATCGAGAGCCACGACCAACCCAGCACAAATGGATTTCACTTCACTTTCACGAAGACGACGACGATGAAGACAGAGCGATCCTTCCTGGCTCCGTCATTGA
AAAGACCAAAGCGTTCGCTTCTCCAGCCACCACGGAGAAACTCCAGACCTGGCTAAGCAACGGGAAATCCATCGACGACGTCTTCATTGGCTTGCAGCTT
ACCAAGGCTGGCGATACACTACTAGACAATCTGCAGTTCACGACGTGGCTCGTGTATGTGGACGATTTCACTGCCAATAATCCTGGCAAGACAACGTCAG
CGATCGCTACACTCACCACTCACTACGGCGACGAAGCGGTCGCGAAGATTCTCGACGCTGCGAAAAAGGTAGCGGGGACGAAGGAAGTGGCCACCAAGTT
GGAGACTGCGCAGATGCAGACTTGGCTGGCGAGCGGGAAAACTGCCGACCGTGTTTTCAAACTCCTGAAACTGGATAAGGCGGGGGACGGCATCCTCAGC
AACCCAGCCTTCGCGTCTTGGAACACGTAGCTGAAGATTTCCAATAAGGCCCATCCCGGTCAAAAGACAAGTACCTTCGCGAAATTGACGTGCAATACGG
CGAGGTGGGTGTATCTCGGGTAGTCGAAGCTGCATTGAAGGCCACGAGTTCCTCCGACATCGCGAAAACAGTACAAGCCGAGCAATTCGAGCGCTGGATG
GCCAATGGGAAAACTACTGATAATGTTTTCAAGCTGCTGGCACTTCACAAAGCAAGAAAGAGGCTTCTTGGGAACCCTCTTTTGAATACCTTTACCAAAT
ACATGAACACTTACAACAAGGGGAACCCCGACCAGGAAGTCACTTTGATAGGGACGATAACGACTTACTACGGGGATGTACGTCTAGCCAAGTTACTTGC
AGCGGGAAGGAACGTCCCGGGCACGTCGAACATCGCCACAAACTTGGATGCTGCGCAGTACAAACTCTGGATGAGCGGGCGGAAAGACCCGGACGATATC
TTTACGATGTTAGGCCTAGAGAAGGCTGGGAATGGCCTTCTTTCCAACCCGCTATTCACCACGTTTACAAAGTTCACGGACGCCTATCACGCCAAGCATC
TTGACATCAAGATGACTACGAATTGGATTGTGAGGACCCACTATACCGATTTTGACGTCACTAAAATGATCCTTGCAGCGGAGAAGGTGCCAGTGCCCAG
AGCGCTGGAAAACGTATGGAGGCTGTACTGTTCAAAGACTGGATGAAATCTCCGGATAACGCGTTCAAGGCACTCAAACTTGAACAAGTTAATCCCTCAA
CGCTGTTCGAACGCCCGATGTTCGCGTATTGGATGAAGTTCATGGATGATTTCCACAAGGCTTTCCCGGTAACAATATCCCTCGGACCGTTCTAACGACG
GCCTACAAGGACGAAGATCTGGTAAAGGTGGTCGAAATGGCGCAAACGAACCCGAACTCGAAGGATCTTGCGAACAAGTTGGAGATAGAGATGTTCAAGC
AGTTCATATTCGCAGAAAAACAACCGATCGATGTTGCCAAACTTCTACACGTTAGTGAAAAGACCGATGCGAATTGGAAACTTTGGAAGAAGTACATGCA
GGACTATCACAAGCACCACCCGGGAAAGGTCACGATCAAGTCGTCCACGTAGTTCCGAGAGACCGTAGATTCGCGTTTCTTGTAAAGCACTTCCGTCGTG
CTTTCTCTTCTCATGAACGTAACATAGCATATAATCCTTGATAACCTGGAACTTGACGTAAGGTGTCAGGTGTCAGGTGTCAGGTATCAGCCTTAAACTA
CACGTGGATGTACCCAGCAACGTTGGAGGCCATAACCATAACCATACCTTGCTACTTATGTGCTATCATAGCTACCCTTTTCGACGGTGTGTGAGAGACC
CTACTATGCAGATTCAAGTGAACAATGACTTTAGTGCGCTGTGTAATTGCCAGGAGGTGAGGCAAGTCCTATTGTAGTTTTGCTGCACGCCTGGTGGAAC
AGGATTTATTGGTGTTCTTGTTTGTTCCTCTGTCCGTTGCATCTAGCTGGGAGCCAAGAGGTTTTATGGTCAACCCGTTACCAAGGAATGTCGACCGTCC
CGAACGGGTATTCGCCTGCGTTGGGCGTGGAGTTCGAGCAGAGCGAGCTGCGGATTGTGGTCTTGTTGTACACATCACAGTCGGTCTCAGGCTCGATGGC
GACCCAGAACTCGCTGTCTCCGCATCTTCTTCAAGCGCTTGCCGATATGCGGGTGGTACACCCCCCAGTCGTCAGCCGTGAGCGTGAACTGCACGCCCCG
CGTCTCACCTACTTCCAGGCGGATTTTGGAAAACTTCTTGCGCTGCTTCATCTCAGGCACGTTTGAGGAACAACATCACGGCCTCTTGCACGACATCGAC
CCGCTGTTCGTCACGTCCATGGAGACGGTGGTCGAACTATTCGGGTCCTGGATCGTGTTCTTACTCAGGGTAACAGTCGAGTACGTGAAGTCGGTGTAGC
TCAACCCCGTACCAAAGCCCCACTGATTTTCGCAATAGAACGGATCCCCAGTATGTTCTTACACATGGTTGGCACGGGGTGGTTCTACACCGTCTCAACG
TTAGCGAGGTCCTTCGGGTACATGATCAGCACTAGCCGAGCGCCGCCCGAGTTGCGGGCAGTGGTGTGCATGTTTAGTTGGTGCCCGTTTGCTCGCTCAT
CCAGCTCGCTTCACTACTATTTTTACTATGACAGGGTTATGTTTTATTCAGTATATTTACTTTTGACTTGAACCACAACCCTAAGCCCGCTACGGCTCGC
AAGCTTCGCCTCCGCTTATCTACCATGCACTGCTTGGTCCTGGGTTTCACCCGCGTGCTTCGCACACGGCTTCAAACCACAGGCGTACTCGCTGCGCTCG
AGGGGAATGGTGACTCTCAACAATTACCGCTATGCAAAGTGACAAATGTATTCCTTTCGTAAAATATGCATTCACACGAAGTCGCTGCCTACGCCCTCTC
GAACAGCTGTCGGTACACTATGCTCGCCGTGTACACTCCGTCTTCTTCCTCCCGCTCTGGATACTCGACCAACGCCTTGAATCTCGATCTGACATAACCC
TTGACATGGCCACATACAGCTGACCGTGGGAAAAGCAAGGAGTCGCCAAGTACAGTCCCAGGTACTGCACCGTTTGTCCCTGCGCCTTGTTGATCGTCAT
GGCAAAGGCAGTCTGGATAGGAAACTGCCTGCGTCTCAGTCGAAATGGGAAATCGCGGATGTCGCCATCGCTGATGAACACGATGCGGGATCAACACATG
CTGGCCTTGCCTGTCGCCGGCCATGATAGTGGCGTGGATGACATGATCTTTGAGTTCGACGATTCGCAGGCGGTTCCGTTGCACAACCCCAGGTCAGGAT
TTAAGTTCCGCATCATGATGATCGGCATCCCCTTCTTGAGTTTCAGCTTGTGGGGTGGGATGCCACTGATGTTCAGGGAGTTTCCTGCTTGAATAAGTTC
CCGTCCTCTTCATCCTCCACTGAGTCTGTGGACACATATTCTTGAGATGGCCCAGTCATACGATCCGCTACGGCTTCGTTGATACGATGGACTATCGCGT
TCGTGGTGGTGAGGATGGTGCGACTCGCAAAGTACTCGTCCGATGCGACTTCCGAATTGTTGATGTCGGCGTACATCTCGTCGATCATGCGCCGCATACC
TCGCGGAATAGCTCCCGGTCGGATCTCCTCGTCCTCATCTGGATCACCGGCGGGGTTGTCGATGATGGAATCTTAATGTAGTCATTTCCCAGATCATTGT
GTACCTCGTGTCTCTCCTCTCCAACGTTCAGCAGGTACTCAGAAAACGCAGCCATTTCTGAAGCACTATCGGAGGTGGCAGCCGTATGTTCTTTGTCAGA
CGCACCTTATGGAAAATGGCCACCGTTCGGATGACTTCAGGCATGCGTCGATTGTCTCTGTCGCCGAGCCGCCCTTCACCACCTGGAGAATTTGCCTGGA
ATCTCTCTGAAACTCGACCACGTATGGGAATGAAAAGAAACGTTGTTGAAAGGCGGTGTATTTTGTCCAATCAGCAGTGATTTCATTCGGCTACTTCCGA
TGTGATGTAGTCCACTCTACGCATTATAATAGCCAATCGCGCAGAGGCTCCACTATATAGCCAACGAGAGGCCTCATATTATAATTATAGCGAATAGGGA
GGCCACCTTCGCTGCGCTCGGCAGCTATTTATAGCCAACGGAAAGTCCGGACTTGCGTTACGGTCCGGGTGCGTACGGAATGACGGACAGACGGACGGAC
GGACAGGTTACTCTGT