Description :
From Genome Similarity Track
Location :
Scaffold_31:292751- 322180
Transcript NameFunction/comments
Phyci_27231conserved hypothetical protein
Phyci_92312Hypothetical protein
Phyci_6154Hypothetical protein
Phyci_92314Hypothetical protein
Phyci_308198Hypothetical protein
Phyci_92317conserved hypothetical protein
Phyci_79847myosinlike protein putative
Phyci_221554Hypothetical protein
Phyci_454077Hypothetical protein
Phyci_65055glycerate kinase
Phyci_273410protein serine/threonine kinase
Phyci_103772Hypothetical protein
Phyci_923253'5'cyclic nucleotide phosphodiesterase putative
Phyci_103774conserved hypothetical protein
Phyci_221529mitochondrial Rho GTPase putative

Sequence
29429 bases(100 bases per row)
CGGCCTCACGCTTGTTGCGAGCCATTGATGCCAGTCAAAAAGTGACTCAATCGGGCTAAAGTTGCCCTAAAGTTGCTACAAGCAGAGGTGTTCAACTGAA
TAAACGTGGTCATTGTCTCCACACTAAACTGCATAGGTATCTCCTGGCTCTCCTAAGTGAGCCACACGCTCTTGACGTCGTCGTGGCCGAACATCTTTTT
GCATGTGGGGCACTTGCGGTTGCGCGACTTGAGGTTGTTCTCGATGCACTCCTTGCAAAACATGTGGAAGCACTTGGAGATGATCACGTCCTTGCGTCGG
TCCTGGCAGACCGAGCAGTTGACGAGCTTCTGCAGGTCGCGCAGCTCGAAGCGCTCGAGGTCGGTGAGCTCGCCTGTGGAAGACGCCGACTTGGCGTGCT
GCAGCTGGCGCTCAACGTCCTCGATCTTCTTGCGGTACGCGTCGCACTTCTCGCACGGCTTCGGCTTCTCCTGCAGCAACTGCTGCTCACGCTGCGACTT
CTCCGCAGTCGCACAGATCTTCTTTGCTACCTCTGCATCGCGTAATAACTTCCGCTTTTCCGCGTCCGACGCTTCACGCTCTGCCTCGATGGTGTTGACA
TAATCTTTCATCTTCTCCAATTCAATCTCCTTTGCTTGCAAAGATTCCTACATATCGAAGCGTATGTCAGCATTCGACATTTGACAGTAACGCAGCACCA
CGCGCTTACCTTTGACGACTCGATGAATGCTTTTTGGTGCTTGTGCACTGTGCTCAGCGATGAAACTTGTAGCCTGACAGCAGCGAGCTCTTCGAAGCAA
TGTGCTTTCGCCTGCTCCTCCCTGGCAAGCAGCGTGTGCAATTTCTTGTTCGCGCTGCGCTTCTCGTCGATCTGTTGAATATATCTCTTCCGGCTATGGC
GCATTGAATCCACCTCCTTTGAGATGGTATCAATTTCGAGCAGCAACGCATCGTTCTCTTCTCGTGAGGCTTCACTAGCAGCCTTCATATCCTCGATTTT
AGTCCGTAGTTTTTCTCGGTCACTTCTGCATTCGTGCAGCTCTTGCCTTTCTTTTTCGAGTTCAGCCTCTATCTCTGATAAGCTCTTCAAGGCATCTGAC
AGCTTTTCACCAGCATTTTTCCTGTCAGCAGCAAGCAATGACCGTCAGTTCCCCAAACCACTGCAAGTTACTTCGGCTTCAGCCAGATTCTAAGCGTACA
TTTCTGCTTGCTTCAGCGCATCGTACTTCTGCTGCAACTCCAGCTTCTCCTTTTCAAGCAGAGTTACCTACTCAAACACAAAACCCCGTCAGATATCATG
AAATCTAAAACCCAACGATCTAAGAAAGAGAAAAGCAACCTTCTCTGTTAGTGTCTGGATCGCGTGGCTATCTGCAGAGGACTGTGCTCGATCTGCTCGG
CTCCGCTCGCGTTCGAATTGTGCCTTCAGATTAGTGTTTTCACGCTTGGCTAACTCCAGCTCCGCCTTAACTTCCGTTAGCTTCAAACCGAAGAGAAAAC
AAGGTCAGTATGTGAAGCTGCAATTCCACTTGGATGAATAACTATTACCTGATCTCGGTAGGTCGATGCGTTTGAGATCTTTTCTCGGAGTGATACGTTC
TTCAAATTCAGCTCGTCCATTTGTGCTTTGGTCTTGCTCATTTCACCTTGGATCTTCGTGATCTTCTTTTCCCATTTCTCGGTCATGTGGTGTTCGAGGT
CCTGAGAACGTGAAGTATACAAAAGTGCCACACCCAGACGAATTTTTATCAGTATCTACCAAAATGTGAGGCGGTTTCGAATGTAACCACGCTACCTTCG
CCTTGTGCAAAAGTTTCTTATACTCCTCTTCGCCGTGCGCCTTCTCATCTCGGAGTTGCTTAATTTTTTCTTCGTTGTCTTGAATCAGGGCTGCTTCATC
GTTTTTCCACTAATCCGTGCAGTTAAAAACAAGTGTGAGCACCACGGCAAATGCACCCACAACTGCATTACTGGGTTACTCACCGCCACTTCCAGCGCCT
TGAACTTTTCCAACTCCCGCCGCATAGACTCAATTTTCTGGCGCTCTTGGTGTAGTTTCTTACTCAATACCCCCATGTTTTCATGCAAGGTTCCAACAAT
CTTAGCGTGCTCCTTCTCTTTCTTTGCCAATTCTTCCTGTTTCACCGTTCCAGCACTCGACGATCCTGACGTGGACTTTTCACGAGAGTTTTCTTTATCT
GGGACTTGCTCGGTTTTAATACCATCCGCATCGACACCATCCGTATGTACACCTCCCTGTTGCTTCACAAATGCGCTTAAGCGGTCGTAGTCTCGACAAG
CCCTGTGACGCTCAGTTTCCTTGTATTCTACATCACGCTCGAGGTCAGCTATCCGAGCTTTGCACTGCATCATAACGCAATTTCTCAGTCAGCTCCAATA
CCCTCAACAATCCCCACAGCCATTTTTACAGCCGCACGCACCGACTGTAGTTGTCCCTTTAAGCACAGCGTCTCCGCGATTGCAGCTCGTTTTTCCTGCA
AAATGTGCGCGTACTCAATAGTTTTCGTTTTGTCTGCCGCAACACTTCCCACTGCAGCGAGCAATTTCTGCAGCAACTCCTTCGTCTTGTCGCTCCTGAG
TTTCAACTGGTCATGCACTTCCTGCTCCATCCTCGTCAAGTGCTCCGCCTTAATAAACGTCTTGTCATCAACGTCGTCATCGGACGGCAATGCCACATCG
GCGTCAGGTTCGTCTTCCTCCGCGTCTTTGGCCACCGTGATAAACCACTCGGGCAGGTTGAGCTTGATCTCCTCCGCGCGGACGCGGACCTGTCCGAAGC
CGTCCACGGCGTCCAGCGCCGCCTGCCAGGCCTCCTTGGACGCCTCATCCGAGACGGCCGAGGGGTCCACGGTCTTGGTGGCAGCCAGCAGCTCGTCCTG
CAGCTGGACCCACTGTCTCCTCAGACAGCGGAAGGACGCGCCCGTGACGCCCCTGGAGCGGTACAGCGCCTCGCACTTGCTGGCCAGGTAGGCGATGCGC
CGGTTCTTCTCCCTCATGTCGATCTCCAGCGCCTTGTTCTTCTCCCTCACGGCCTCGATCGTGTTGGGGTTCGCCTCGGGCGGCGTCGGGTCCTCCAGCT
TCATCTTCTTGGCGGCAGACGCGCCCGCGGGCAGCGCCTCGCGCCGCTTGCGGTGGCCCACGCCGTTCTGTGCTCCGGTGTCCGCCATGGCTCTCGCTCC
GAGTCCCTGCTGCCGTCACGCGCCGTCGCCGTCCGCTCGGATCTTGGCGCTCCCCCTCCAGTACCAGTGGCTCAGTATGGTATTGAAACCCTCCCTTCTT
CGTGACCTCCTAAACCAACGGGATTTGCGTAAATCGGGGCCTAAAACCGTGGTTCGTATTTTTTTCGGACAGCTTATTTCTTACCCTAGATCCCGAACAC
AGCACGCAGCACCGCGAAGCTCAGCGGCACAATGCTGATGAACATCGCCGCCGCAATGGCGAAAAGCAGCAGGGTGCGGGACTTGGCCTTGCGCACGATT
TTGATCAGGCACAGACGCCCTAGCAGCGTCATCACGAAACCCAAAGGCATCATGAGCTTGGCCAGGTTCAGGTCCAGCTTGCCCCACAGGAAGAAGTTGA
AGGAGGCCACTGCAGCACACACACACAATACAGCACAAACGACAGGTTGTTACTCCGTGACGAGCTCGGCAGCAATACAGTGGCAAGTGAGACAGCAACT
TACTGCCGCTCACTAAGAACACAGCCGTGGCGGACATGGCGGACACCGCCGCCGGGGAGAAGTTGACTCCGCGCAGCAAGCGCGACGTCGCACCTTCACC
GCCGACGCCAAACGCTCCTGCAACTGCGCCAATACCTAGCAGATGGAGAGGCAATTTTCTGATGGACTCGGGCGACCACTGTGAAAACAGAGTAATGGTT
AGCTGCCGTTTGCACTTGAGTTCAAGGCGACAGCGTTGCCCGCATTGCCTTACCTGGACTTCATTCGGAGCGAGGATGAATCGCGGGTTTTGCTGCCGCT
GGTACGTGGCCACGACGTCTTTCATCTGGTAGTGCGAGACAACCGACAGGAAGATGAAGGGCAGCATGGAGACCAGCAAGAAGAAGAACGAGGTCGGCGG
GATTCCGAGTGGACTGGGGAAGTATTTTCCTCCTTGGAGCGACGTGAGCAGCACTGTGGCAACGAATAGGCCAAAGTTGATGCCCAACTTGCGCCATGGG
AGGTTAGCCTTATACTGGAATCCGCCGTCATCATCCTAGCGTTTCATTAAGCGCACGAACTTAGGCATCAGCACATGAATCGATACAAGCATCAGTTATC
AGTGCAGATACACACCTGAAAGCTTGTGGATGGTGCGCCAAGCAACGACATCGTTTCCCCACTGTTGCACCACCGCCAACCCTCTTCGTGTCCAACGGCT
CGAGCCTTCTTGAATGCTTTCTTGCCGATGTATCCCAGATACACGACTAGCGCAATGATTAGCAGCCAAGTGGAGAACCACGAGATCAACGATGCCCCAA
AGCCAGCTCCCACTGAGAAGAACAACCGCATCCACTTAGTCAATTGCATCAAGACAGAATAGGCTACTCAGATCATAGCCACGTACTGAGTAGCATGGGC
TGCATCATCAGTATGAAGTCCCAGTTAATCAGCGAGAAGTTGGAGTTGATCGGCTTCTTCCAGAGGTTCAACAGGAAGTCGCAAATAGCTACAGACAGCA
CAACGTCAGAACTCTAACGCTTATTGCACCCATCTAAGATGGGCTTACCTCCGCCGAAAATGGTAATGCTGGCCAGCGGGATAGCCTCCTATGATGGCGA
GAAAAGGTGAGAAAACACTTTGACACCGCACCGATGAAGTCTAGTATATCAATACGTACGTCCGGCCCGAGCTTCAGCACCAAAATGAAGACGGCGTCCA
ACACGGCGCCACCGCCGGTCTTGGCCCCCGACGCGATGAGCACCACCAGAGCGGCCAGCACGAGTCCGAGCAGCTGGTGGGGCCGCTCCATTGAGCGCAG
CACCTCCCGCGGCTCGTAGGGCTCGCCCTGCGGCGGGAGCGTCGGCACGGGGCCGAACTTCACGGGGCTGTCCTCCCCTCCAGGTGGCTGCGCAGCAGCC
AACGCCGCTGCCAGCGCCAGCGCGGCCAAGGCGCGCGCGAGATCTCCTCGACGGCCCATCACGTTCCCGTTCTTCCTTGAAGCGAATCTAACAAAAGTGA
GTCCCAACTTAGCTTTGAAGGAGCGAAATTCACATTTTGAAATCGGTACATGTATTATCAAAGTACTAAAGTGAATTTGGCATTGAAGTTGTAAAATATG
TAAATACTGATCAGGCGAAGAGCGCTCGGACACTCTCGACGCTCATGGCGACGGCGCTGATGAGAACGATCACGGCCATGGAGAAGATGATCAGGCTTGG
GCACTGGAAGCGGCGCACGACCTTGAGCAGACACAGGTGGCCAATGTACGTCGTGAGGAACCCCATGGGCAGCATGAGCTGCGCGAGCTGCAGATCCATC
TTCCCCATCACCAGGTAGTTGAACGACGACACTGGCAACATCGCAGCACGAGTGAGACTTCAAGCAGGGACTAGCAGTGTTTTGGCACAAGTGGCGGGAT
ACTTACTTCCGCTGGAGAAGAGCACGGTCGCAGCAGTCATGGCCGAAGCGGCCGAGGGGTCGATCCCCACCTCTAGCAGTAGCGGCGCGTTGATGATGCC
TCCGCCGATTCCAAACATGCCGGAGACTGCTCCAGCCGCGAACGAGAAAGCGGGGAAGAACCCGATCGAGGACGCCGTCCACTGGATTCCCCCACATGAG
CAACAAAGTGAGAATACTGGTGAGAAAGCGAGTCCTGGTGGCATCGCTGCGCTTAAGCTTACCTTAATTTCGTGCGCTTCAGGCTCGTATTGAGGGTTCT
GCTGCTTCTGGTAGGTGACCCCCAGGTTCGTAAGCGAGAAGTAGCTGACACCGACGAGGACCAGATAAGGCAGTGCCACGAGCACGGGGTACAGGGCTGA
GGATGCATCGATGCCCAGCGGGCTGTCGAAGTTTTGCCCTCCACGGACGATCCTCATTCCAGCGATAACGACAAAAAGACCTAATAGTGTAGCGAGTTTC
CTCCACGGTACATCGGCACGAAGCTGTGGCTCCCCGGTAGGGGTCTTGGACGGATCAACGCTAAGAAGTGACGACGACTCTGGCGACACACCACACTGCC
ACCGCTCTTTTTGACGGGCGCTGATGGCTTTTTGCAGAGTTCGAGTGCCCGTGACGCTGAGAACCAGCACCAACAGCACAGACAGGAGCCATGTCGGCAT
GATCGTGTTCAAGACAGTGCCACAGGTTGCTCCCACTACAAAACACACGAACACGTCCACGGGTGAGAACACGGTGATCATCACGTTGATAAAAAAAGTA
GCCGGTGGCTGATCGCGACGTACACAGAAGGAGTGGCTGCATCACGAGGATGACATCCCAGTCGATGAGCGGTTTGGTGGAGTTCTCCCTAGTGCGACGG
ATGTTCAAGAAGAAGTTGCCAATGGCTGAATGAGGCAAAACCATAATGTTGTGTACAGGTGAGCAGGATCACTAAAGCAGCAAGGAGTAAAGACACATCG
TTGACTAACCCCCGCCGAGGATCGTTATGCTTGAAAGAGGGATCGCGGTCTGCAAGATTCAACCAGTTACAAGTCAGTTGACAGCACACAGGGCAATGCA
CACAAGACCGGTCGAACCTTGGCGCTGAGCCCGCACACGAGGATGTAAATCGGATCCAGCACGCCTCCTCCGCCAGTGCCTCCCCCGGCGGCGACGAAGA
TGACCAGCGCCGCAAGCGCCATGCCGAACGCCTCGCGTTGCGAAAGGCCGTCGACCTCGTCGACTCCTGGAACCACAGCTTCATCCGCTGGCGACGGCAC
CGAAGCCGGCTCGCTGCGCAATGTTTGCGCGTGCATCGCTGCTAGTGTCAGCGATCCCAGCAGCAACAGCAGAGTGGTGCCTGGTCGCATGCGCAGCCCG
AGTCGAAGCTGCATGTTCCTGCGGAGGAGCAAAACCGGGAGTGCAGCCCGTGAACAGCAGTGGCAAAAGGCAACAGGCGTTGCTGCAGAGCCGAATCCTG
CGAGCCTCGTCAGCGGCGCGCGCGGCCAATCACCGCCAGCGGAGGACCAACGTGTTGCAGCGGAGACCGTCTCGCAGAGATAGACACGCTAGTTTGCCGC
TGGCTGATTGGCTGAGACCGGGGCGCGTCGCTTCAGCCTGATAACGGGCCACTTCAAGCGGAGATTCCTGCACTTTGAATTTCGCGCCCAGCACCGGAAC
GCGGGTTTGCACTGAAGCAGGACCAACAAGACCTAATAGCTGCATCGAGCACATTTCGCCTTGGCGAGCTAGTCCTACCTTGCGTCTGCCTCGTGCTGTT
GCGTTGGGCTTGCCGGCCGAAAGGTGGTTGGGTGGACAACTACCCACTACAATATGCGGTCGCGGCAGAGTGTGCACCTGGCCGCGCCGAATCCGCGTGG
CGGAGACGGCGGCGTCACCTGCAGTGATAGCACACGTCACCATGGGTGTAGTAACCCAGCTGCAGCCCCGGATCTTCTCCGGTGATACTGCTCAACAAGA
ACGGGGACCAAATCGGGTCGCTCGGTGGAACACGGACACAGGCATTTCACCGGATGCAGTGTCGGAGTCAAGACAATGGCTGGTAATTTTTCTAGAATTC
AATTGCTACACTCCTCGAACTACCTAATAATGGGTAACGCGTCAAAACTCATGCACGCCGTCGCGGGGTCGGTCGCCTCTCATCTACTGGAGCGAGCACG
GGATAGAAGCGCTCTCCTCCTCTGTGGCCGCACTCACCGGGAACGGCACGTCGGCGAATGAGAAATCGTCCTTGAGCTCCACCGCGAAGCAGACCGCGAG
CCTGCCGTACTTGGCCGAGTTCGTCCACCCAGGGTACTGCGACCGCAGCACGATCGACACGCAGTCGCCCAGCTTGACATGCTGCAGCAGCCCCGAGGAG
CCGCTGAAGTACTTGCGGTGGTGGCGGAAGTTCCTGCCCGCGCGGAGATTGGGGCAGAACGGCACGCGAGCCGTCTCCCTGATCTCGCCCTCCGCAGCCA
CGGACGTCACCGCCACCTCGCTCCAGGAGCTCGACTCGCGGTACGTGCCGTTGTACTCGCGTCCGTCTGTGGCCCAGCCCTGGTCTTTCGACACGCAGTC
CGCCACCACCAACGAGCACTTGCTCACGTCCACGCCGGCCGGAATCTGCAGCTCCTCGGCGGTCGGCAGCTGCAGCTGCAGGTAGTCCTCGTTCATGTCA
CCGTGGCCGCGCCGGAGATCCGACGTCTCGGCCTGGAAGGCCAGCAGCACGCCCGCGAACTCGAGGATGTTGTTGAGCACGTCCACCGGGAGCTGGCGCC
GCGCCACGACAGACGCGATGTAGAGGACCTCATCAATCGGGCGCGGCTGAACCACCGAAAGCTGCTCCTCCTGCGTCATCTGGTGCGCCTCGCTGGCCGA
GAAGATGGCGTCGTCCACGAGGAACACGCCCTCGTCCGTCGCCGCCACCATGCTGCTTGCTCGTCTGCTTGACTAATTTCCTACTTTGTCTGATTCCTTC
GTTTTCTTCTCGCATCTCTCACACTCTTATTAGAAGGAGGGGGCATTAATTCAGTTTTCACAGTACTTGTGGGCATGGTCAAGTTGAAGTGCCCGCAAGT
TCCACGCGGCACGTCGGCGCAAACCAGTACGTCGCACGTCGAATTCAACGCGTCGATGGTGTTGGAGGGTGCCTGATTCATACTCGACGGCGCGATAAAG
GTTTGTTCTCGGAGAAAGCGCTGCATTGCAATACAAGAGCTTGAAGGGTTTTGAGCCCAACGTCGCTTACGCTTTAGCTGCGTGGAGCTTGCTTGGGCAA
GAAGTCTGTCTCTTGAATCGTTCCGAAACTGTTCCTTGGCCTTTGCTGCAAGCACTTGCTGCAAGCACCTGGTGCTGGTTGCCGGACGATCAAATTGCCG
CAGAAACCCCCGCCAAACTCAATTGAACCCCCAACCCCATTTTTTGGGTTTTGGTCGCGGATTCTCAGGTCACAACTGGGGCAGCGCCGATAATGCAGCA
GCAGCGCGAGAAGGAGACGCGCAAGCCTCGCCAGCAGCAGCTCGTGTTCTCCACCAAGAGGGCGGGGCGCAAGGCCAAGGCACGTCAGCAGCAGCAGGCC
CCGGCATCCGCGGAAGACGCGAAGCCCGCGTCGCAGAGCAGGCTCGAGCAGCATGAGACGAGCGCCTCGCCCCTAGACGCGCAGGAGCGAGCGCGCCACC
GCTCGAGCCGCAGCAACCACGGCCACAGCCGCTCCGTGAAGCGCATGCGGCCGTCGCGCGCGCTGCTGCAGGGCGACCACGCGACGGTGGCGCAATGCGT
GCGTGCCATGGTGGAGCGGAAGACGGACGCCGCGCTGCTCGTGGACAGGAGCGGGCTGCTCACAGGCATCCTCACGGACCGAGACGTCGCCGTGAAGGTG
GTGGCGGTGGGCAGAGACCCCACGCGGACGCTGGCGTACGAGGTCATGACGCCCGACCCGTCGTGCGTGTCGGCCAATGCCAGCGCCATCGACGCGCTGA
AGAAGATGATTTCGGGACAGTTCCGCCACTTGCCAGTGACGGACAATGACAAAGGTGAGGGGGGAGGGAGAGGAGAGTGGAGGGGTGATGTGCGTGAGGC
TTGACAGTGTGTGGGTTTTTGTGGTTTGTGATCTGTAGTGGTGGGCATTCTGGACATTGCCAAGTGCCTGTATGAAGCCATCGCGAAGCTGGAGCACGCG
TACCGAAAGTCCTCCGACCGGCTGGAAGAGACCGTGAAGAAGGTACTGAAGAGATGTATAGAGTAGAATGAGGAGTTTTGCAATGGCTGACGACACGGGG
TGGGTTGCGTGTCGGGTTGACTGTAGCTGCAAGAGAGCCTGTCGGGGTCCACAGAAGCTAACTTATTCGAGTCCTTACGCCAAAAGGTAAGGGTCCTGAA
AACGCGTTTGTGCAGTGTGCGTCGCACTGACATCGTGTTGTATATTCGTCTGTAGCTTTTTCTGCCGACTCTATCGGCGATTATCATGGAAGGCTCCGAG
GTGCCAGTTCTCAGTCTGATGTCTACAGCTATGGACGCAGCACGCATGATGTTGATACAGAAGACTAGTGCCGTGATGGTGTGCGATGAAGCAGATCGCA
CTGTTGGCATTTTTACTTCAAAGGATTTGATGCGGCGAGTGGTGGCACTATCGCTGGAGCCTAACCAATGCTTGCTTTCTGGCGTGATGACGCCCGAGCC
TCAGACAGCCACGCTGGGAACGACGATTTTGGAGACGCTTCACTCGATGCACAACGGAAAATTCCTGCATGTACCCGTGTTTGACAGCGATAAAAACCTG
GTGGGTATTGTAGACGTGCTACAAGTTACCCACGGCGTCGTCCAACAAATGGGCACGTTTCAGAGCGTGAAAAGTGATGGAGTACAACCACTGTGGGATC
AATTTCGCAATAGTTTGAAAAGTGCCAACGATGCCACAGAGCACGAAGAAGTTGACGACGACGGATCCAACGTTGGTGTTGACGATCCGGATGCGGATGA
TGTGGACATTGCGTCGCTAGTGGGGCGCCGAACGTGGAGCGATTTCCAGTCGTCAACTGGAACAAGTGTTACTGGTGACCCCGCGCTGCTGGATGAAAAC
CCATTAAACGAGCATGCACCCCTGACGTGTTTGTGTACAAGCTTGCCGACTGCTACGGCAACAACCATCGTTTCACAAGTTCTGCTGAGTCGGTGAAGCA
ATTGCTTGTGGATGTCCAGAACCGACTGGGTGACAACACTATCCGCCGAATCCTTTACGTCGACGACGAAGGCGACCATGTACGTTGTGTTTTGCGTCGT
CTTGACTCATCCCAAGTTTTGTTTAATCTGACGGTTCATTTGCTTAAATCGTAGGTGTTACTGTCCGAGGATTCAGACTTGAAGGATGCCGTTAACCGAG
CTCGCACATGGGGAAACAAATACATCCGACTTAAGATCCCTCACTATCGACTCGCGGTGCGCCGTGCGTTGGGGCAAAACAGCGATACAGCGATCGGTAT
GGTCGTGTACGCCGCTGCTGTAGCTGCACTTGCGGGCGCATCGTTTTTCTTGAGTAGGCGCAAGTGATTAAGCTGCAAGGATGTTGTTGTGCGTCATGAT
GTGTGAGTGGTTACAGGAGACATCACTAGCGCAGGTAACACTGCCAGCATCCCAAAACCAGATCTGTCCCAAAAAAAAGAAAAGAAAGTTTAATAACCAA
AAAAACAATCAAAATTCGCGGCGCTTAAGAAATAAATACGAGCTGCCACGACATCGATTGAAGATGATTCAAGCGAAAACGATAACCATGAAGAAGCCTT
CGAGGCGAGCTGCTTCTGAGGGGGGGGAGGCATCACTGATGGCGGAACGCATTCAGGACGAGATGCGTGAGACCGTTGCCGAGACGTGCATCACACTGAA
GAGTGACAACAAAACAATGGACTTCCATGAAAAGAAGTGTGGGAAGTAGTAGAACAGCGTCCACAGTCCATAGAGGAAGATGCCCGTGAGAACCAGCAGC
GAGTTCTGCGGGTTCAACGCCTTGAGATTCGTTTGGAGAGCTGCTTGCGGATGGGGAGCTGGGGCTGCATGCAACCATTACACAACGCCCACGAAGCCAT
CAATCTCCATATGGTGCAACCTGAATGAAAACTACTCCGTCGTCACTTACGCGCATCGGTAATGACGCTGTGGATCACACCGCTCTCCTCAATGCCGTAC
TCCCCCATGGAGCGCGCCGGGAGCAGCAACATGCCCATGTAGATCAATCGGATCTTCTTGCCATTGGCGAGTTCCTCAGCGAAGAACTGCATCAACCAGG
CAACACCGAGGCTGAGGGTTAGTCGAACGATCTCTACATCAACAAGAGTACGGTGGTTGCGCCTACTTTGTTGACAAAATCGTCGACTTGCTGCGTGGCC
TTGAACCACGCCGGTCGGATCTCCTCTCCTTGGCGCAGTCGAATGGGCAGGTAGCCCTCAGGCACCTCGAGCTCCACTGCTTCCACCGCCTCCTCTTCGT
GCTCCGACCCCTCCGACTTCTGCATCAACAGAAGACAAGAGCACGTGAGTCAGAAGAAAAGCACAGCGGTGGCCTTAGGAGCAGTGCCGTCTTACCGCCT
CGCGTGTGGCCGTCACCGACTCGACGATTCTTCGTGTTCGACGTAGCAGAACAACAAGGAGGCAACTTCTTAGTCTCAGAATGTCGACCATCGAAGAGGC
ATCTCACGCTACGCTACGTACTCTGCGTCGTCGTTCACGAGCGCCCACTCGTCATGCAGGGCGGTAGGAGAGGGAGGAGCTGGAGCCGAGTGCATCGGGC
TGGCTTGGGATGTACAAGAATGAGCAGCAAGCGGCTCGTGAATCTCCTCCGGGCGTGGACGCTTCTTTCGTTATGGCCCGACTCTAGGGATGGGAAAAGC
AACAGACCAAAAGACCAAATCACAAAAAATTTGCCTCACTTCAACATGACCATTTTTTGCCGTCCTCAACCTTATTCTGACGCTGCCGCTTACGTTGCCT
GTGAAAGGGAATTCCGACAATGACTGCGAGCAAGGAGTAGCAAGCTACGGAGCTTGTGTAATTAAGCGTTTTTGGAAGACCCCGAAGGCGTTGAGAAGCA
GTACTTACTGTGAGGTGGCTTGGAGAGTTTGTATTGCATAGAGGATAATATTGGAGACATGGAGCTCGTCCGAGTTCATCGAGAAGGCAAAAATGCTGCT
GCATTCGCCAATACAACTTCGTACGAGTCGTAGTTTTCTGTTTTGAAATGGGAATGGGACGACCGGTGGGTTTATTCCCCCCCTGAGAAATAGTAGGCAG
AACACGGCTCTAAAGACTGGCAGAGCGAGATCTGGCAAGTGCCAACGGATAGCCAATTCGACACGTTCAGGCTCATGCCGATACTTTATTAAGCTACGAA
CCTGTGGGTAGCTGGCGATGTAGGTGGCGAAGGAAGCGAGCAATATGTCCAGGCTTGAGTGTCGCTATCTGTGCTACGTGATGCTCTCGCAGTTCGGCAA
GTGCGTCGATATCATCCCAGCCGTTATCGATGAAAACTTGAAGGAGAGCGCTCTGCCCAATGCTGCCAAGCGAAGTTTCGAGCACTTTCACCACAGCCTC
ATGAGGCAAGATGTCATCACCGTCTGCAGCGGCGGGGATGGCGCAGCTGTCTTGGGTTGGCTTGGGCGGTGTCACCTCATCCCTTCTCGTCTTTCGCCTT
AGCTTTTGTAAACGCATGAGCCACGCTGGAGGCGAAGGGATTTTGAGGTTGGCTTCCACGCGGGTGTCATAAACGCACAGGATCAGGAACTGATAATAGG
GCGCGTTCAGCGCGATGATTGCGATGCCCGCTGCAACGTTAAAGAGCGCGTACTTGAGCGGAAATGCGGCAGGGAACCAGATCATGAAGCCAAACGAGCC
GCAGCCAACGCCGAGGTAGAAGTAAATGGAAGGGAGGGTGAACCACAACTCGAGTCTCTGCAGTAACCGGGCCGCTTGGTAGTCATCCTCGGTTTCGTTC
ACCGCGAGGAGAACAAGTACACTGTTGATCACGGAGAAGAGTAAGAAGAACATGCCTGTGCACAAGAAGACGCTGGCGATGCCCTTCACGTCTCCCGACC
ACGATGAACCATAGTTGTCGAAAGACGTCGCCGCGACAACCTGAAGCCAAGACGCCCAAACGGTGAACACCAGAGCTGATATCAAACCTACGTTGGTGAC
TTTGGTGAAAGCCTGTTCTCGCGTGTTGTCGTGCTCGTGCGGGTCGAAGCCCAGCCAACGAAACGTGTAGGCATCGTACACAATTAGAGGGTCGAACACG
CGCACCATCGTCTGGAGTAAACTCCCCGTGGTAGCCTTGCCGGCACTTGCCGCATCACGAGACGGCTGACCCGACGATCCCTCCACGGCTTGTGCGTTCA
TCTTCCTTTCGCCAGCTCGCGACGACTGCTTGGCTTCCGTCTCCTGCATTCCTTTCTCGCTAAGTTGGCGCCAAGATATCTAAGCGTAGGTGAACGGTCG
CGGCAGACCAGCGCGACAAAATACCTGTACAAACCGAGCAAATGACCAGGGCCACTGCATCATTCGTGCAGTTTACTCTCGCATCAAAGGCAACGACGCG
CGGTTCACGTCTCAGCTTGCACAAAGGTCCTTAGTTGGTCGACTATCACAATGATCTGGTAGTTAAACCGAGGTAATCCGTGATAGATAGGATACTTAAT
TCCCATTCCAACAAATTCGATAGTGGAATAAATAAGTATGACACCCTGTCTACAATGACCGATCCTCGTTTTTATGATTCGGATCGTTTTCCTCCGCGTT
GCAGCTCGCTCACTCGTCAATCAACCAAGACAAGCTCGACCCCCCGACGTGACTAGCATGGCAGCCCGTACGCAGCAGCTGCGCCAGCACATTGAGGCGT
TGATCCGCCGAGACGCCGCCAAGCGCTCGCTGGCCGTGGACGAGCGCGCGCTGCGCCGCCGCGTGGACGACTACTACCTGCCCATGTTCCGCTGGACCAC
GGAGGTCGTGGAGGCCGCGCAGCAGAAGCAGGGCGACGCCAAGCGCTGCGTTTGCATCGGCCTGAGCTGCCCTCAAGGTGGCGGCAAGACCACGGCCTCC
GTTTACATGCAGGAGGCGCTGGCGCTCATGGGCAAGAAGTGCGCCGTCATGTCGCTGGACGACGTCTACTGGAAGTACGAGCAGCAGGTGGCGCTCGCCA
AGGCCAACCCTGGCAACCCGCTGCTCCAGGTGCGTGGATGGTATAATTGCTCGTAAGCTTAGTGCGAGAGGTGGCACTTACTTACTGGGGCGTGTTGCAG
TACCGAGGAAACCCGGGCACGATGGACGTGCCATTCCTGATGGACTTGGTTCGCGAGTGCAAGACTTCCACCGCCGAGATCGCTCTGCCACGCTACGACA
AGTCGCAGCACAATGGCCGCGGCGATCGAGCGCCTCTTTCCGAGTGGGACCGCAAGCAAGGTGCGGGACGAAAGGAACATGTGAAGCTTTAGTGGTACCC
GTACAGATCTAAAGTCGCCTTTATCGATTCTCCAGGTCCGCTGGACGTGTTGCTGATTGAAGGCTGGTGCATGGGCTTCCAAGCGCTCGACGATACCAGT
TCCGAGCTCAGGTACACCCAGCGATGTTGGAATTCTGATGCAGTTAAAGAACTGGAGCATTAATCCGTCATTTGTGCTGCAGTGAGCACATGAAGGCTGT
GAACAAGGAACTGCGTGCATTCGACGAGTTCTACGAAGAGCTCGACGGTCTGGTTGTGATTAAAATCGACAACTTGGACTGGGTCTACCAGTACGTTGTG
CAGCAGATTTTGCTACCCTATCAGCGCAAGCCTGTCGGCACCGGTAGCACCTCTAACCGACCTCCTGTCTGCTGAGCAGGTGGCGCGAGCAGCCAGAACA
GCTCCTGCGGGAAGCCAAGAAGCCAGCTATGACCCCCGACGAGGTGCGCGACTTCGTGGACCGCTTCATGCCGGCGTACAAGACGTACCTCAAGGGTCTC
TACGCCAACCCGAAGGACTCGACGTCGCCCTTGGCCACGGTCCCGCGCCTCATCTTCTCCATCACTTCGGCGCGCGAGCCGTTGGCTAAGCCAGTGGAGT
TCAACTTCACGTCTGAAGCGCTTCAGGATTAGCTAGAAACGTCCGATCTCAGGAAAAAATTGACCGGCTTTCATTTCACCCATGCTGCGATTTCCCATCG
TGGGTGTTTCTATTTTCATCCCTATAATGCTTGGGTTGCATAGTCCAAGGATGATTTAAACCGATGGACTTTTTCGATTTGAGCTCCCACCCACAGAAGG
AAAACGGGTGATTATAGCACCCAGCGGAGCCTGTCAGATTCGGAGACCAACGCCGCTCGGCCCACCCACCCACACGCGCGCCCGAGCCCATGGAGCGGTA
CCAGAAGCTGGAGAAGATCGGCGAAGGCACGTACGGCGTGGTGTACAAGGCCAAGGACCGCGTGACGGGCGAGGTGATCGCGCTCAAGAAGATCCGCCTG
GAGGCCGAGGACGAGGGCATCCCCAGCACGGCCATCCGCGAGATCTCGCTGCTCAAGGAGCTGCAGCACTGCAACATCGTGCGCCTGTACAACATCGTGC
ACACGGAGCGGAAGCTCACGCTCGTGTTCGAGTACCTGGACCAGGACCTCAAGAAGTACCTGGACGTCTGCGAGAAGGGCCTGGAGAAGCCCATCCTCAA
GTCCTTCCTGTACCAGCTCCTGCGCGGCATCGCCTACTGCCACCAGCACCGCGTGCTGCACCGGTGCGTCTCCTGTCCATTGTTGCATTGCCATAGCTCT
CTCTTCGAGGTGGATGGAGCTTGCAGAGCAATGGAAAAAGGGGGATGCTGACTAATGCATCTTTCGTTGTTGTTGTTGTGTGGACAAATAGTGATCTGAA
GCCGCAGAACCTGCTCATCAACCGCGAGGGAGAACTCAAGCTTGGCGACTTTGGCCTGGCCCGTGCTTTCGGCATCCCTGTGAGAAGCTACACGCATGAG
GTCGTGACGCTTTGGTACCGCGCGCCTGATGTCCTCATGGGATCACGGTACGTTTCGATATTTGCTCGGGACGCACAGTTTGCAACGTGCGATGGAGTAT
TGAGTTGTGTGCACTCATTTCGTTCTTGACGCGTACGATGTTTTGCTAGGAAATACTCGACGCCTGTTGATATTTGGAGTGTGGGCTGCATCTTCGCGGA
GATGGCCAACGGCGGGCCGCTGTTCGCTGGCACATCGGAGGCTGACCAACTCGACCGCATCTTCCGCTTGCTTGGGACACCTACGGTTGAGATCTACCCT
GCTATCGTGGATCTTCCGGACTACAGGGTGAGGATATGTCTTGCTCCCTACATCTTCCTATAGTACTTTACATTTAACCATTCGTTTGTATCTCCAGCGG
GACTTCCCTGTGTACCCGACGCCGGACAACCTGGCACATCTCGTACCGACGCTTGACGCTGATGGTGTGGACTTGCTCGAGCAAATGCTGCAGTACGACC
CGGCAAAGCGTATCACCGCGGCTGATGCTATGCTCCACCCGTATTTTAGCGACTTGTCCTCGGCGCTTACTGAAAACCAATGAGGCGTGGAACGGCAGCG
TCAAGCGGTTGGCAGCACAAGAATTATCAGTGGAATCCTGACAAACGAGTGGATGGTTCCATGTAGTAGTTTTTGCCTGTATTGCTGTCCGTCCATAGAA
GCATTTCAGTTCTTGTGTTGTGATGATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCGCCTCGATT
GTCCAGCTCTGCTCTGGAACGCAGCATACTGGCCCAGCAACTTGTTGGCTTGCAGTTCCAGCGCAAGTGAGGCAGCGAATGCTAGTAGCGTCAGCGTCCA
CTACACTCAGCGATGAATGGGATGTGGAGTCTGAAGCTGCCGCACTCCCGGTGGTTCGAACCTGCCGTCGTGCTCAAGACACTCGGCCGGCTAGATGCTT
GCTCCTCTGGCTCGAGATGAGCAGGACGCTCACCAAACGAGATGCTAGCGACGCGCTCGAGGTTGCTACTGTGCTATGCAGAGGTTTTTGTGGTAAAGTG
GAAGCTCTGAAGCAATGCGTAAAGCAAGTTTCGCCGCATATGCGGGTCGGTGCAGGGAAAGAAATCAGCACTCTACGACTCTGCCAGTCCATTGGGGACG
GCGAAAATTTATCTGCCGTTGTTCAGTGTACGTCCAAGCTTGGCAGAAAACACGTCGCTCCTAGTACGATTACCCAAGTTTGCGCTGAGACTTCCCATAT
TCGAGGAATTCAACCGCATACCTGCTTTTTGGAGGCGCAGCAAAAACTCCGGTGGATGGATCAAGCTACTCAAATATCTTTATGCAAGGATCCCGCTGCA
CACGCAACAGTCACCCCAGTTGTATGTGCTATGGAGATAAAGATTACATCTCGATCGTTGCTATCTTCTAGTTCTCCACCAAAGGAATTTAATTTGCTCG
TAGCCAGCTTGTGCCGCAGCGCTACCAATGCCAGTACCGTGATTGAATGTGTGCGACGTCTACCAGTTCGTGCGTTCACTGCAGACCAGGCTATACGTCT
TTGTGCGGCCTCGTCCATGCCTACTGCAAATGATTGTGGTGATGACGCTGTTGTCTCGCTCTACCCGACAAGCTGTGCTTCTCAAGCCCGACTCTTTCTC
CAACGAGCAAGTTTGGTATCTGGCTTGAACGACCTGGGCATGTCGGCATCTGCAGCTGCTGTGTACATTTGCGAACGAGCCACATCAGATGCACCAAGCA
AATGTTTAGCAGACACACAACACGATCAAACGCTTTCAGTCAAACTCCGGGTGAAGCTCTGCCAACGCGCGACTTCTGATGCTCCACAACTATGCATGAA
GTCACTTCGGAAATTTGTCAATGCACAGCGCCTCGATACTTATGATGCGGTAGCCGCATGTCGTCAAGCAGAGCATTTGGGCCCCGCCGATTGTGTGACC
AAATTGTTTCAAGCTGCTCCCGCACCGTCAGGCAATGTAGCAGCTCAACTTTGCCACGCCGCAAACAACTCGGAGCCTGCTCACTGCTACTCAGCGTCAC
CGCTTGCATATGACGACGAATTGAAGATATCGCTTTGCAAGCAGGCTGAAAGCACCGCTCCAGCATTATGCGCTGCATCAGTGATCACTCGCATCGCCAA
CCAGCCATCCGTGAAGGTAGCTTTGTGTCGCGGTGCAACCACATCTGCGCCCGTGGCCTGTGCCATCGAGGCCCCGTTTGGAATGGATGAAGCTAACTTG
GTGACGCTGTGTCAATCCGCGAAGAGTACTGCACCTGCAAGGTGTGCGCAGGAAGTACCGACGTTTTTGCGTGTTCCCTGGGACAAGGTGGCTCAAGTGT
GTGCTAATGCTACATCAACGATACCTGGGCGCTGTTTGGCGCACCATATCCGGCACTCTCGCTTTATGCTTCGTGCTCTAGACAGCATCCAAATTATGGT
CAAGTGCCGACTTGCGGTGGCACAACCTTCAGCATTGGGACTCGCGCAGGCGTCGTACAATTGTCCGGAGCTCCGCCCAATGTGTTCTTTGCAGCTCGTG
GTAAATGTGCTTGATCAATACGGCGATCTCTTGGCTGAAACCCACCTTCATCAAAGCCATAGCAATACCGTCGTGTACGTGAGCGGCAAATTTACGGGGG
CTCATGACCAGGAGAACAACTATCTCCGTCGCGGGCAACCAACCGTGCAAGGATCCACGTACGCCACGATCACGAATGGTACAGCGGTGTTCTCAAATCT
ACTTTTTACTGGTGCAGGAGAATTCACCCTCACATTTCGAGCAGGTGAAGGTGTCACCGAAGAAGTCGCGCGCGTAGTCGTGCATCCCGACCTCGCGGCC
GAAGCCTTGCAAACTCGATGCGACAAGTTGTTCACACGCTTCCAGTGCAATATCCAGTCCCCCGCACGCGACTACCAGCACCGTGAACTGCAAACATTGG
TGCTGCCACGAGCTGTCCATTTGAACGCCATTTCATGCGAGCGGTACTGGATCGACAACATCGGCGGCCTCACGTTCAGTGGCTTCTCGTCTCTTAACGA
CTTGCTCTACATCCTCCCGCGCCCGCTCTACGACCTCTTCACGTGCGTAGTTCGCCTTCAACTTCTCTCCCTCTCTCCTTCCCCTCACTAACGTTTTTGC
ATGATTGTCCTCATCAGAAACTCTGATGTCCCCCGCGCGGACATGAGTGCTTGGGCTCTGCTGGGCCTGAAGGAGGACGAGTCAAGTCGCGCCGCCATTC
GCCGAGCCTACCACCAGCGCTCACTGGAGTGGCACCCGGACAAATGGCACGCACTGGCGGCAGCACTGCCCTCGACGTGGCAGCAGGAGCTGGCTGGCGT
CTACGCGCTGATCACGCAGGCCTACGACCAGCTCACGCATACAGCCGCACGTTAAACCAGCTCAACTTCAACACGAAACCTATTGACTTAGTACATCTTC
CGACCAATCAGAAGCCGACCAGATGGCGAGGCAGTGTTCGCCGGTTCGAAAGTCTCACAACAGGAAGAAGCCATCGGCCATGCAGGACGCGCTGCTGGCG
ATTCTGCGCGGCGTCCGCAATGGGTCCTTCTACGGCACCAAGGTGCGCGCGCCGCACGGTACGTGACTCGTTCTGTGCGCTGCTGCCACGAGGCTCGCAG
TGCTGAGCTGACGGGGCTTCTGTGTGTGTGTCTTGCGTGTGGACAGCGATGGTCATGATCTTCCTGTTCCAGAAGGGGTCTGTGCGCCAGAAGCTCCGTG
GCATCGTGCGCCTCACGTTCGAGCACAGCAAGAACCTGGCGCTGTTCGTGGGCGTGTACAAGTCGGTGCTGGCGGTGCTGCGAGCGCACCAGCAGCACGC
GCTCGGGCAGCACGTGACTTCGACCGTGGGGAAGCCCGGCGCGCACTGGCACGCGGCGGTGGCCGGCGGTATTGGCGGCTACCTGGTGTGGGGCCGCTAC
TCGAGCGTCAACTACCAGATCATCATGTACCTGCTGTCGCGTGCGCTCATCAGCCTGGTGCGCGTGCTGGCCGCCAGAGGGTACCAGCCCTTCGCGCAGC
ACCGCTTCAAGCACGTGTACCCGCTGCTGGCCACCGTGGTCTGGGCCGGCGTCATGTGGCTCTACGAGAACGAGCCGCACACGCTGCACCCGTCGCTGCT
GAAGAGCATGCAGTTCCTCTACGACGAGTCGTGCCGCTGGAAGGACGGGCTTGTGGAGTTCCTCCCGTCGCCGGCCACGACCGCCGTCTTTTTGCTGACG
TGGCTCCGGATTTAAGCGAGCGGTGACGTCTGCAGGACTTCTCCAACCGCTACAGAAAGCTTCGTCCCAGCGTTTTCGCGGTGCCGCCATCACCCAGTGC
CGACTTCTTCGCAGAGCTCGTCGCAATGCTTGGCGCGCCCGGCCGCGGCTCGTCTCCGTCGACGGTAGCTGTAAAACGCGGGGCGTCGCTCGTGACTCGA
CTCGTTACTTGAAGCAAATAATAGTTACTGTCGCGTGTGTACACAGGTTCCTGTTGACGAGCCCTGGCAAAAAGGCCACGCGTTGGTGCATGTGGAGACC
GCCGCAAAAGTTAGTTAACCCCGCCCGGCGGCAAATCGTTTGCAGTGAAGGACACACGTCCTTGGCGCGCCTGATTGCTGGTAGATGGCGATTTTCCTTC
CGCCACGGCATCGGGGAGTTGTCGAGGACATTCGTGCATGCCTTTGCATGCATGGTCCATCCAACACCGTGCGCCATGGAAATGCGGTGCTGGTCGGTAG
CCGTGATCGACGAACCGTCTCAAGCTGTTGAGGTCCGTATTCTCAGGTCCGACCCTACAGGATACTAAATGTAGTGTTGCATCCGTAACCGTTAAAGCGA
GGGATACGAATTGCGTTGCGACAACAAGCAAATACAGCGACAGACAGCGCGGAGCACCGAAAAGTACCAAAACAGCGAAGCCAAGCCAAACCACGGCACA
GCGCCGAACGGTGCCCAACGGCCCGCGCCTCCGCACTCGTTGGCATTTGTCGCTGCAGCCCTGCATTAAGCGACGGCCGTCGGGGACGTTGAAGCCGCGG
TCGCGAAAGAACTGCTGGTTGAGACATATCCTCCGTGTTCTATTTCGAGCCAACTTGGCGCGGGGCAGCTCGGCGCGCGGACGGGGCGAGGCGCCTCACG
CGGGGCAGACCTGCGGGTTTGTGAACTTGCCACGTTTTACTTTTTAAAACTTACCCCTGGTGAACAATAGGGGCCTTCTAAGATGTACGCGGGTTTCATG
TGGTTGCTCTCGAACGCGATGGTAACATTTTTTTTTCGGATAGACGGTGCGGTGGCTTGATGCGGCTCACTTCAGACATTCAAAGTTCTGCAGCAAGCAA
TACCCGGCGTCGTCGCAGGAAACGTACGATAGTGGATACGATGAATCGGTCTGTCAAACTCGCAGCCAAATTGAAGGTCGAAAACGAGTGGAAGAAAACG
ATGTTATGCTGATCGAGGTATTTTACAAACGACCAGGAAAGGGATGTTTTCTCCTGTGCGAGAATAACGATGTTAAAGGCACTATCCTCGTCACACAAGC
TAAGACTGCAGTCCAGCACAGCTGCCAAAGCGCTGGGACAGACAGAACCCTGATTCTTTTACAGGTTAATCGTGTCTTTTAATCCCATCGCGGATGTGCC
TGAAGATGGGGTGTGTTGCAGGCCGGTTTACGGGCCGTGAGCGAGGCTATTTGGCGGCGCCCAACACGATGGACGCGAGTCGCGGCACCTTTGCCCGCAC
TTCGCCAGGCTTTTCATTGCCAGCGAGTTTACGCTATCAAAAAAACTGCTAAACAAAAAACTCGGGGAGAGTGCGCCGCCTCAAATCGTAACTAAGCGAG
CGGGTGAGGGACACATAGAGAAGAAGCATGCTGCGGAGTCGCTTGGTACGTCGCAGACGGAGGTCAGTTTTTGCCCGCCTGGGCGGCACTCGCCACTCGC
TGGAGGCCCCCACTTTCAAGTCCGCACCTGCGCTGGCATATCGCACGGCGACGAGCGTGCGAGTGGGCGAGCGGCGAGAGCGCCGGGAAGAGGTCGAGCG
GGGCGAGCCGTGGCGGCCGTCCATGGGCGAGAGGGGAGCCGCCTCATTCCACTTTTCCACTGAGACGCGCGACACGCCACCGGGCAATTGAAGTGGAGCG
AGCGAGGCTCGGGGACCAGAAACCGATAGGAAACGAACCCGCGCAAGGAGGAGAGAGACACAGATACAGATCTAGTACAGACATGGGGAACGTCTTGAGC
AGTGGCGGCGTCAGGGACGCCCACGCGCCCCAGCAACAACAGCAACAGAAGCAGGCGACACCTTCGCCCGTCAAGAGGCCGAAGGAGAAGGCGCACTCGC
TGTCGGACACGACGGTGTCCTCCTCGCAGGGCAGCGACGACGGCGACGAGCCCGTGCAGCGGACGCCTGGCCGCCGCAGACGGAGAGAGAGCGCCGAGAG
CCCGGCGCTGGATACCACGGGCATCCACTACAGTTCTGCCAAAGACAGGAGCTCTTCCGGGGCGAGCGCCTCGGCGCTGTCGCTCGTGAACGGCGTGCTG
TCCTGGCTCATGTCGTGCGCCGGCGGCTCGTCGAGCCCCGCCCACACTGACGACCAGTCGGACTACGACGAGCGCTACTTGACGGAGCAGAAGCACCGGG
CCTTCTGGGAGCTAGTGCAGCGCATCTTGGATCTCAATGACGTGGTGCTCATGATCCGACTGCTGCTGGATTTTCTACAGGACGACCTCGGCGCCGCAGC
GGCCGCCGTCTTCTTGGTGGACCAGAACTCACAGAGCATGTCCCGCATCACGCGAGGCGTACCGACACAGTCCGGGTTGGCACCGTCTCGAGGACTAGTA
GGAGAGGCGCTGAGGTCGAGAGTAGCCCGTTTCTTGGTGAACTTTAGCTCTGAAGAAGGATACGATCCGGAAGTGGACTTGGCGCAGGACGTCCCGGGGC
AAAAACTGTTTTGCGTGCCGCTGATGGAGCACGATTCGGTGTATGCGATCATTGAGGCTACGACTGCTCACCCTACGCAGCGGGTGATGGATGAACTCCA
CGTGAAGTTGTTGACGTGGCTTGGACCGATTTTGAGTTCGTGCATGCGGAAGTGCATCGAGTTTCACGACGTCTTGCTGTCAGAGCGCACGCAGAAGGCC
CTACTGCACATTATTAGCTCATCGGATACGGAAGACACCGTGTTGAATCTCGTGGACGGTGTGATCGACGGCGCTTGCCATATCACCAAGGCCGAGCGTG
TGTCGCTTTTCATGATTGACTGGGAGACCGACGAGCTATGGTCCCTTTCGTCTAGTTACTATGATGAGACGCTTCGTGTTCCTCTTCGAGCGAGTATGCT
GGGTCTTGCAGCCACGACGCAGCAAACCCTCAATGTCCGCAACCCGAAAACAGATCGGCGCTACAACTGGATGACGGATCAGCGTCGCGGCATCCACACG
CGCTGCGTACTTTACGTGCCTGTGGGCATTCAGGAATCTTCTCAGAATAACGAAGGGGTGTCTGCTACTAGCAATCGACCCATTGCTGTGCTGGAGATTA
TCAACAAAGTGGAGGAGGAGGTTCCAAGCGGGATAACTCCCGGATGCTGCCCGGGCTTTACGTTCGACGACGAGTGTGCTCTTGAAGCTTTTGCATGCGA
GGTTGCGGTCATTCTACGTCGGCGAAGCAACGAAATTGAGTATATCAAGCTGTTGGCGGACACGAGAGCGGAGCAGGTGTTGGCGAAACGTGCTCGAAGT
CAAGTAAATCTGCTAGAATGCTACACGAGTTATGCATCTGCAGTTAGCTCCCACCCTGAAGCTTGCCTTCGCAATTCGTTCGTCCCGAGTGATCGTCATG
TGGCAGACTGCCCCGAATGCGCCGCTGCGGCCAAGCAAAAGGATGAACAACCTTCTTCAGGTGCTCCAGTACTCAATGATGATGTGAATGAACATGTGCA
CCCATTGGACAATGTCGTCGAGCAGCGGCTCGGGAAAGCTGCAGGGAATAAGAACCACCATTCTGGTCGATTGGGCTACGAGTTTGTGGGGAGCGATGAA
AGCATTTCGTCTGGATTACTCTTCAGTGCACCACCAGGATCTCGGTTCCCCTCGTGGGATTTTAACGTTTTTACAACGGACCCGGCGGCACTCCCGAAGC
TATTGGAAGAAATGTACCTGGACTTCAAGGTCGACGAGGTGTTGCAAACGACAAAACACCGTCTGCAAAACTTTATCGTGGCGATGAAGGAGCACTATCA
CCCAAACCCGTTCCACAACTTCCTGCACGCTTTCTCGGTCGTTCATGCTGCTTATCTCCTGCTGAGCACGACGGACGCTGGTCAAATGCTTCAACCACTT
GACGTTGCTGCGTGCCTGATTGCGTCGTTAGGGCACGATGTTGACCACCCTGGCCACACGAATGACTTCGAGGTCAAGTCCGGTTCGCAATTGGCAATGC
TTTACAGCGACGAGTCCGTACTGGAACATCACCATGCCTACACGACATTTCGCTTGATTTCCAAGGAGAAAAATGCGAACATCCTGCAAAATCTGACCCC
CGTCGATTATCGCCATGTGCGAAAAATGGTGATTAATGCGATTCTGGGTACGGATATGGCGAACCATTTCAAGTTCTTGGAGTCCCTGGAGAAGGTTCTT
CGCCCATCGAGTCACCACGTTGATACGACTGCAATTTCTTCTGCCAAGCGCGATAATTCTAGCGTCACTGCCATTATCGCAGTCAGCAGTGGGGCAAAGC
CAATGTTTGAGCTCACGACTGCCAAGGATCAGGCGAAACAGGGCCCAGAAATTCTGACAGTGTTACGCGACGCTGTAATGCAACCTGAAGGCTCAGTAGC
CGGAACTCCTCGTGGCAGCACTAGTGGATCCGCGCCCAACAGTTTTACAGGTGCCAAATGCGCACCTGGCCGTTCGTTCAGCGGGCGATCGACGAAGGGA
GGGTGGGCTTACAACGGCACTGTGGAGGACCGGTTGTTCCTCGTGAAGACGCTGGTGCACGCGAGCGATCTGTCCGGCCAAGTGTTCCCGAAACCGGTTG
CCTTGAAATGGAGTAACATGATATCGAAGGAATTTGCGTATCAGGCGCTAATGGAGCAGGCGGAGAACATTCCGATATCGTACAGGAACATCGATGATCC
TCTAAAGATGGTCGAGGGCCAGCTCTTCTTTGCTCAAAAGATCGTCTCGCCGCTCTGGGACCTCATGTACATCATGTTCCCGGATATCGACGAGTGTATG
TCGAACCTGAGATCGAATGTCGCGCATTACGAGCAGGAGCTACAGCGTCTCAAGCAAGCGCGGTTCGAGGAAGGTATGGATGCTGATCGCATGCGGGAAG
AGCGTGATGAACTCGTGAGGCAGTATGAGCAAGAGGAGGCGGATCAACAACCCAGCAGGAGGACACGTCGCGACTCGATGTGCGGCTGTGAAGATGAGGG
CGTGGCGGTACCGGGGCTTGCCAGACATAATCCTGCCAAGTTCAATTCGTTCCGCACGATTCCGGAGGACGATACCAACAGCAATAGTAATAGTGACGGA
GCCGAGGTAGGATCGGACGGTGAGCCTGGCGTCCGCGCCAACGTGCTCGCTGCGGCGGAGAGGTCTCGCCAGGCAACTCGCTCAAGGTCCAGCAGTGTTA
GCAGTAGCAGCAGTAGCGACTTGGAGGTAGACGAGCAATCGCTCGAAGTGTACGAATAAAAAAAATACCCCGCTCTAGTATGCTGTCGAACATAAGACTA
GCTGCTTGTATTGATCTAAAATGACTGCTTGGCTGATGTGCCCGCGGAAAGTGAACGGGGAGAACATACAAGGTCCCGCCGACACTCGAAACAGTGTTTG
GTTTTGCTGTCGACGTGCTCGGAGCAAAAGTATCCATCGCAGCGTGAACATTTGGCTGCTTGCGAAAAGAGTGCGAAGACGAAATGGCACTCGCGCGCGT
TGCAGTACCATTCCGGGCGATCAGGAAACTCGAGCATTGGACGCGCTGCCACTTGCCAGGTCTGTCGAATCGATATCTTTACATTCTCCGGAGATTTAGG
GGTGTCAGCGTCTTGGTTTGGCTGCGCTAGGTCAATTGTTCTTGGAAAACTATCGTCAAAAAAGCGAGGTGACCCAAGCCAGGATATCGCGGCTGGTGAG
TTCAAAAACTCAAGCGACGACGACTCAGATACGCTTCGACTTAGCGTCAGATTGCCTCCAATCCGACTGCATGCCGATACCGTGGTCGCCGTTGACGTAC
TTGACCCCCTAGATCGACCGCAGCCCAGATTAGACAAATCATGTGCTACCTCCTCGCCATTGTTGCCGTCCACGCACTCGTCACAAATATTAAGCATCGC
CATGGTTGGCTCAGACAGCCGACGATCCCTGCCGAATCCTCGAACACGTCCACCACCTGTGCAGTTAGCTTTCGGGCACTGGTGCTTGAAAATACAGAGA
GCGTGCTGTGATTTACAGCAGAATCGGAACTCGCAGTGGCCGCATACTGCTGTCTCCAGGGCCAGCACGTCGAACTTAGTGTTGCAGTAGAGGCACACCT
CTTCTTTTTCTAATACAAGTCGCGCTGCTGTCGTGTCACGCCGCTTCCAGCGATGTGCCAACTCCAGCGGCGAATACCTCCGCATGCTGGTTTCCTGCAT
ACGCGCTCCGTGGGCAAGCAGTAAACGCACCATGTCGGGCTGGTTTCGAATTACACTAAAATGCAGCGGCGTAAGACCGGCATCATCTCGATTGTCGACG
TCGGCGTTGCAACGATCGATGGCCAAGCACGCAACGGATACACGCCCATACCAGATAGCGTAGTGGAGAATCTCGTTAGCCAGGACGACACTCGCGGTAG
CACTATAGTGTCGGCGAATAACGTGGGCTTCCCACAACCGGCGCACCAGAGACCCGTTTCCTGACCGAACGGCATCAGCCATCTCCGGGGGTAGCGTGCG
ATGCAATCCGAAGCCTCCCAGCGATGATACTGATTCTTCGTCACCCTCAGCGGAGCTGCTATCACTGCTGGAAGCACCGGTGTCACTGCACGAAGGCGCG
ACCGCACCCACCGTTCTGAGAAAATGCTCTCGGGATACATGTACAGTTGTGTCTTCACGATGCATCTTGGGGTTTGGTCGAAGTGCCAGGGCCTGCAGTA
TGACCTGGTAAGGATCGAGTTCGCGGACGAGCGGCTTAAACTCACGTAAAAAGTCCTCGAACGTCATGCACATGAGTTTGGCCTCCAGGAGCTTGAGAAT
GGCTAGTCCTGCTCGTAAGAAAACGTCCTGCACCCCCACGAAGAAAAGGTCAAATATCGCGCACGCGAGCTCTGTCTTGGTCGACAACGAGAAGAGCGTC
GTGAACCATTCGATGCCGTACATGGGGATCGCGAAACCCTGCGCCAGCAGGTGGGCGTGCAGCTTGGGCAGATCGCGAATGAACATCCGCTCAAAGTGCT
GGAGGTACTCGTCCAAGAACGTGGAGCTACGATGGTAAATCCCCGCCAAGTGGCGCTTTTTCAGCATGTAGAGGAAGAGTGCGTACGCGTCCGCCTCGGA
CAGCCCTTCCACGAGGAAGAGCGCCGCGATGAAGTTCATGCCCTGGCAGTAGCCGTCCTCGGCCTCGGCGATGGCGTTCAGCACTCGGAAGAGCGCGCTC
TGCTGCGCGGCGAGCTGGTGCTGGTGGCTGCGCTCGAAGATGCTGAAGGTGCGCGTGACGTCGCGGCCGATGGCGCCCGAGCGCTCGTACTCGGGCGACG
AGATGAGGTAGTAGATCTCTCGGTGGCGGCGCACGAAGTCCCGGGGCAGCACGCGCATGTGCATCCAGCTGATGCCCGCGGTGAGCGACAGCAGCAGCTC
CCGCTCCGATTGGTCCGTGAAGTTGAACTGCTTGACCACGTTGCGCCAGAACAGCTGGCGCTTCCTCTCGGGCGCGTGGCACGACGCCATATGCAGCGTC
ACGATGGAGGAGGAGGAActgctgctgctgctgctgctgttgctgGTATTAGCCTCCTGCAGGTCGCAGTTCGAGTGGCGGCGGCGGCGCGTGCTCAGCA
GCTTGGGCGGCGCGGTCTCCGCGGTGGGGATCGAGTCGGTTGGGCCCTTGGGAACCATCGCGGGCCGTTGTTCCTGAGGCGGGCAAAACGCCTCGCGCTG
TCTCTCGCCGGCGCGCGGCACGTCGCGGACTGGCGGCCGCAGCTTCGCTTGCTGTGCTCGGAGCTGGTGGCTCGCTACGGGCTGCTCTAGTGCGCTAAAG
GGGTCCCTTACGCCCGTCCGTTTCCTGCCGAGCTTTTCTGCTGCGGCGCTTCAAGCCAAGTGAGGTCACCTCTGGCGCAGCTGTTCTCAGGTCGTTTTAT
CGATCGGCGATTGGCTGAAAAGGCGACGCGAAACAAGTTGGTGTGCGCGTGGTGTGCAGATACTGTACCGGTACGCAGGAGAGAGAAGAGCATGGCGGCC
ACGGCCGCGTCCAAGCCCGCGCGCGGCGA