Description :
From Genome Similarity Track
Location :
Scaffold_259:2927- 5698
Sequence
2771 bases(100 bases per row)
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NTCACCTTCGTCAGCCGAACGCTAAAGCCGAATGAGCTGAATTACGGAGCGGTGGAGAAGGAGATACTCGCACACCGACGGGTGTTGGATCTCAATTATA
ACCTGCTGGTGGGAAGATCCATCCGGATCTTGACTCGACACTCTACGCTCGCTTGGCTGTTCAAGTCGGCCGATCTACAAGGACGGTTAGGACAATGGGC
AGCTTTACTCTCCCCTCGGACACTGGAGATCGTGAAATGTTCGAAGGGGGAGGACGAGATCCTGGGCGTTTTGGCCGCGAGTATCACACCTAGAGCCAAG
ATGGACGAAGCGCTGACCAGGATCGCTCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCCGATCCCGACGGTACATGTGGATGAGGATCTGTACGTCC
TGAGTTTCGATGGATCTGCTCGCGTGCGACGCGGTGGAGGAGCATACAGCACAATACTGTGGAAACTGCCCGGATGGGAAGTTGTACGGGCCAGATCCAC
TTATGCGGAAGGCCTCACCATCAACGAAGCAGAGTATAACGGGCTCCTGCTGGGTTTGGATGTACTAAAGTGACAGGATCCAAAAAGGCTGGTGATTTGT
GGGATTCAAACTTGGTGATCAGACAGGTGCGATGTGAGATTGACTGCAAGGCCCCGGCCCTAACGCTGTTACGGCAGAAGGCGACGATCCACCTGCGTGG
TTGGATGAATCACGAGTTAGTACATGTCAAGCGAGATTAGAATGCCAGTGCAGATAGCTTGGCCAGTGCCGCTTTATGGAATCAATGTGGTGTCGAAGTG
GAGAGAGAGGCCGAGCATCAGGATCTCGTTACGTTGAACCGACTAGATGAGGTGGTGGTGGTTGGATCCGAAAAAAGGACAGTCCAGGTAATGGCTGTGA
CTAGGTCCAGAGGAAGGATTGGATCCAAGCCCCAGATTCTCAATGAAACATTTGTGAAGGGAGCCCGCATTGAACGGATCCTCAAAGCACAGAACGAAGA
AGCGTGGATCCTGGGACTAAAGAAGTATCTAATGGGGGATGTACGAGACCTGAGTCGGGAGGATACCAAATCCTACAGTGTTATTGCTACGGATTATTCA
GTGGATCTGAATGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCAACGAGGATCGGGATGGATTGATGAGACTGGTGATGCCGGAAACCTTACGAC
AGGATGTCCTACACCACTATCACGCTAGCTTGGAAGGCGGACATCAGGGTATTGGTCGGACCTACCAACGGATCCGGGAATGTTTTCACTGGAGGGGACT
ATTCAAGAGCGTACAACGGTATGTCGGGGAATGTGTGGATTGTGAGACAGGCAAGGGCAGGCCCACAATCGAAGGGGAGTCACCTGGGAATATCCAAGCG
ACTTACCCTTTCCAAATCATAGCCATGGATTATATCCCCTTGTCGCCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGGACCTGTTTACCG
GATACGTGGTAGCCAAAGCTAGTGCGTCTAGAACTGCGCAGACCATTGCTGAATCGTACGAGGAGTGCGTTTTCCAAAGATTTGGAGCTAGCGAGATGAT
TAGACATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCAACCGGATCCTGGGGCAGCGACAGCGAGCAACCATGGCGTATCGCCCCCAA
GCTAACGGATCGGCCGAGCGCATGGTACAGACGATCACGAGAGCACTCAAGATGTATGTCCAGGATTTGGATCAGAGGGATTGGGATGAGTACGCAGAAC
GGCTCCCCTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGATACCCTATTTTACTTGGTACATGGGTGGGATCCCAAATCCACCCTGGAAGCGGC
CATCCCCGTATGCAGCACCAAGAAGAGAAACCGAGATCCAAGGCGATGGCGATACCAAGTCCAGAAATACTACCGGCAAGCTAGATCCCAGGTGAACGAA
CGACTGCGGAGTGCGATACAGGATCGAGCAAATCGACACAGCGAAGATGCCCGTCCACATCAAATCCGAGTGGGATCGCAGGTGTGGCTTTATTTGGATC
GAGTGAAAGAAGGGTACGCCCGCAAATTGGCCCATCTATGGCATGGACCGTTCCGGGTGAGCGAGAAGATCGGAGAACATGCGGTAAAGCTGGAAACGGC
AGGTACCGAATATCGCCTGTTCCCTGTAGTACACGTATCCAAGCTGAAGTTGGTCAAAGAATATCCGGGACGGCCGCAGATCCGTCTTTCGGTGGATGGA
TCCGATCGCGTCGATTTTCGACGAAGTCCTCCTACCGGAAGATAGTTGGAATGTGGATCTCGAAGACGACGAGTTCGAAGTCGAGAAGATCACCGATATG
AGGTCAGGGAAGCGAACTAGATACGGACGAATTTACCTGAATTTCTGGTGTATTGGTGTGGATATGACGAACCCAGTTGGGTAGACGAGGCAGATCTGAA
TTGTGGAGCATTACTCTATGATTTCTTGAGAGATCGTACGAATCGTAACAGATTCGGCGTGATGCAGTCTTATGAAGAAGATTAGGAGGGGGATCCATGG
ATGTGAGTTGGTCATGTCGATGGGAGGATGAAGAAGGACCCACAGGAAGGGTGTGGGCCAGGAGGGGGAGG