Description :
From Genome Similarity Track
Location :
Scaffold_1166:2927- 4773
Sequence
1846 bases(100 bases per row)
CTGAGTCCAGCGTCGCCCGCTCCTCGTAGATCTAGCGTACCTCGAACGACTCCAACCCCATAGAACACGATAACGATGGCCCGATTTGAACAGGCATCCC
CAGGGCCGAAGCCCTGCgctcttccagttgagcTACATCGTTGGGATGAGGGTGGAGTAGGGAGAGTAAAGGAGGTCCGCACGGTAGCGTAGAAAAAGAG
GGAGGGAGGGCTGAGCCTTCGCGAGCGGCACCTAGTCAAGTAAGAGGAAGCGGTATCACGCTCTTACTGGCAGATAGACAGCCAATAGGATTGCTTTGGA
ATGATTGGCTATCGACATGTTTCCAATTATCCGGATAATTTATCCGGACGACTGCAAACTCTCTCCTCATTGTTGAATTTACTCGCTCGAGAGCACATGG
CTCTCAAGTCAAATTTGCATTGTTTTGATATTTTGCATTTTTTCTCAGCCCACTGGCCGTTTCAGGTCATTCATTTCCTTGCGCCTATAAACATGACTGA
TACACGCTCTCTTTAGAGCTCATCCCACTATTTCTCCCCTGAATACTTTTACATCGTCTCCACATAAATATTTTGTGGCAAACACAGATGTACCAAGAAT
TAGGTACTGGTCACTCAAGTCCTTAAGTCCGATAAATTTTGGTATGGTGCCAATTCGGATTTCGATTCGATGGCGGTCGAATTGAGTGCCTATTTGAAAA
TCGACAAGGTTGAATGTGAAACCCCCTAACACATGTATGTGGGGTAAGACGGAATGACATTAAAGTTTGTAATTTTTGTCTTTGCATTTTCCACGAGCAA
TTTGTAACTGTTTGTGAGGTTAAACATATCACGTGTCGGTTTCTCACTGTGTCGTCCCTTTACAGAAGCGTCTGGTTGGTTACGTAAACATGCTCCAGGA
GGGGCTCGAACCCTCGACCTGCGGCTCATAAGACCACCGCTCTAACCAACTGAGCTACAGGAGCGGTGGATTAGGACTTGCAAAAATTTTAAACAAAATA
AGAATTTAATTAGGGACAGAACAAGAAAATACCAAGGCAGCACTAGGTAACTGTCTAGCTTTGTACCGCTTCTAAAACCTGGGAGTCATTTTTTCCGTGT
TGCTCTCACCGCTCTGGATGTTCCAGTTGACAGTGTGTATGACAATGACGCTGGCACTGCCAGGCCTGGAGGTCGCGGTGTAAATGATACAAGTGACCCC
AATAGGTCAAAATGatcagtacatgtaactaGTCAGTCATCCCTGGGAATGAATGAAAACTTCACTACTTCTGCAACTTCACTCGTTGTAGAAAGCGATA
TCGGAAGGGCCCCACGGCTGTGGTCTGGCTCGAGGGATCTATATATCAACGGGGGAGGGGTGTTTGTAAAAATTCGGGCTAATATCGCTAGTTTGAGGAA
AAGTTACGTAAAAACAAAATTATGCCTTAGAGACGGAGCCCACGGAAGCGGTGTTACCGTATAATGCATGTCAGAGGCGGCCCCCATCTGCAAAGGTGCT
GCTCAAACCCTGCCATATTCGATAAAAAAATGCGGATTCACCTTTGACACACACTGCTTATATTTTGGTGTGACACACACTAATTCTGGAAATTGCCCTG
TGGTTCTCGAAGTGACGACCAAACACAAGCATTAATAGCAGACGTCACAATATTTTAGCAACCGAGGTTACATCCATCTGCCTGGGACGCTAGGCAGACG
CTTCGTGAAACCACAGTGCCAGCTGCCACTGAAAGCATCGTCCACAATCTGCAACTacctccttgatcttcaaATGCAGCATTGTCGACGCTATAGGTAC
GCTGTTCGTTCTGTAGTCATTCACCCATTTGACGCTGGCGAGCTCT